Flow cytometric bead sandwich assay based on split aptamer - ACS

Subscriber access provided by UNIV OF DURHAM

Article

Flow cytometric bead sandwich assay based on split aptamer Luyao Shen, Tao Bing, Xiangjun Liu, Junyan Wang, Linlin Wang, Nan Zhang, and Dihua Shangguan ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.7b16192 • Publication Date (Web): 25 Dec 2017 Downloaded from http://pubs.acs.org on December 26, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Applied Materials & Interfaces is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 21 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Flow cytometric bead sandwich assay based on split aptamer Luyao Shen, a,b Tao Bing, *a,b Xiangjun Liu, a,b Junyan Wang, a,b Linlin Wang, a,b Nan Zhang a,b and Dihua Shangguan *a,b a

Beijing National Laboratory for Molecular Sciences, Key Laboratory of Analytical Chemistry

for Living Biosystems, CAS Research/Education Center for Excellence in Molecular Sciences, Institute of Chemistry, Chinese Academy of Sciences, Beijing, 100190, China. b

University of Chinese Academy of Sciences, Beijing, 100049, China.

KEYWORDS: split aptamer; flow cytometric bead assay; L-selectin; sandwich assay; protein detection

ABSTRACT: A few aptamers still bind their targets after being split into two moieties. Split aptamers have shown great potential in the development of aptameric sensors. However, only a few split aptamers have been generated because of lack of knowledge on the binding structure of their parent aptamers. Here, we report the design of a new split aptamer and a flow cytometric bead sandwich assay using a split aptamer instead of double antibodies. Through DMS footprinting and mutation assay, we figured out the target-binding moiety and the structurestabilizing moiety of the L-selectin aptamer, Sgc-3b. By separating the duplex strand in the structure-stabilizing moiety, we obtained a split aptamer that bound L-selectin. After

ACS Paragon Plus Environment

1

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 21

optimization of one part of the split sequence to eliminate the nonspecific binding of the split sequence pair, we developed a split-aptamer-based cytometric bead assay (SACBA) for the detection of soluble L-selectin. SACBA showed good sensitivity and selectivity to L-selectin, and was successfully applied for the detection of spiked L-selectin in the human serum. The strategies for generating split aptamers and designing split-aptamer-based sandwich assay are simple and efficient, and show good practicability in aptamer engineering.

INTRODUCTION Aptamers are single strand DNA or RNA oligonucleotides generated by an in vitro selection technique termed systematic evolution of ligands by exponential enrichment (SELEX)1-4. They exhibit high selectivity and affinity to their targets with dissociation constant (Kd) usually in the pico- to nano-molar range5. Compared to antibodies, aptamers have several advantages, such as low molecular weight, easily achieved chemical synthesis with high reproducibility, flexible modification with various reporter molecules, good stability and the ability for long-term storage at room temperature, and reusability after denaturing and renaturing, which offer the possibility to overcome the limitations of antibodies6-8. Because of the ease of chemical synthesis and modification, aptamers have been engineered to process various smart properties, and are widely used in molecular devices, biosensors, affinity separation materials and therapeutic agents9-15. A few aptamers can still bind their targets to form a ternary complex after being split into two moieties, such as aptamers for ATP, cocaine, 17β-estradiol, D-vasopressin, theophylline and thrombin.8, 16-18 Recently, these split aptamers have attracted increasing attention in the design of aptameric sensors because of their high specificity resulting from the dual recognition mechanism and good flexibility in aptamer engineering19. However, despite the fact that a large


2

Page 3 of 21 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


number of aptamers have been reported, only these aptamers have been validly constructed into split aptamers8. The lack of reliable method to separate an aptamer greatly limits the application of split aptamers. Recently, Heemstra’s group has reported a method named split aptamer proximity ligation to successfully engineer four aptamers into split aptamers20. This method is based on the screening of the optimal split aptamer from many sequence pairs separated from a parent aptamer using azide-alkyne cycloaddition as ligation chemistry. The parent aptamers are small-molecule-binding aptamers with three-way junction architecture, and their target smallmolecules are supposed to bind in the pocket formed by aptamers. Up to date, only one split aptamer for proteins is reported, i.e. the thrombin binding aptamer, whose structure is well studied21. Actually, it is hard to obtain a split aptamer before properly understanding the binding structure of that aptamer. The sandwich immunoassay is a common strategy for protein detection and has been adapted to various platforms. For example, flow cytometric bead immunoassay uses microbeads as the solid support for the capture of antibodies, and a flow cytometer as detector22-23. This method has some advantages over enzyme linked immunosorbent assay (ELISA), such as a rapid assay, reasonable costs and the ability for simultaneous multiple-target detection with small volumes24. However, all sandwich immunoassay methods need optimally paired antibodies against different epitopes25. The reliability, reproducibility and stability of antibodies greatly affect the accuracy of each assay, as do the efficiency of immobilization and labelling of antibodies26. Given the advantages of aptamers, split-aptamer-based sandwich assay has shown great promise in sandwich assays8. Herein, we report a rational design of a split aptamer of L-selectin based on an in-depth study of the binding structure of its parent aptamer, Sgc-3b. Using this spilt aptamer, we developed a


3


Page 4 of 21

split-aptamer-based cytometric bead assay (SACBA) for the detection of soluble L-selectin (Scheme 1).

Scheme 1. Schematic illustration of split-aptamer-based cytometric bead assay (SACBA). Aptamer Sgc-3b is split into 3b-L and 3b-S. In the absence of L-selectin, only biotin labeled 3b-S can be captured by streptavidin-coated microbeads (no fluorescence); in the present of Lselectin, FAM-3b-L, biotin-3b-S and L-selectin form a ternary complex and captured by streptavidin-coated microbeads (strong fluorescence). EXPERIMENTAL SECTION Materials. L-selectin was obtained from Sino Biological Inc. (Beijing, China). DNA sequences were synthesized and purified by Shanghai Sangon Biotech Co., Ltd. (Shanghai, China), as listed in Table S1 and S2. The streptavidin-coated polystyrene microbeads (0.5%, w/v; binding capacity, 0.179 nmol of biotin-FITC to 1.0 mg of beads) were purchased from Spherotech, Inc. (Lake Forest, USA). α-Chymotrypsin was purchased from Solarbio (Beijing, China). Thrombin, hemoglobin and transferrin were purchased from Sigma-Aldrich Co. LLC (St Louis, USA). Human albumin was purchased from MP Biomedicals, LLC (Illkirch, France). Albumin bovine V (BSA) was purchased from Amresco Inc. (OH, USA). The oligonucleotides were dissolved in a binding buffer (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 2 mM


4

Page 5 of 21 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


KH2PO4, 5 mM MgCl2, pH 7.4). Human L-selectin ELISA kit (BMS206) was purchased from Thermo Fisher Scientific. (Waltham, MA, USA). In the experiments, all polyacrylamide gels were visualized by Typhoon (Typhoon Trio, GE Healthcare). The fluorescence intensity of cells and microbeads was recorded by a BD FACSCalibur flow cytometer (Becton, Dickinson and Company, USA) by counting 10,000 events. Electrophoresis mobility shift assay. Initially, FAM-labeled aptamer Sgc-3b (50 nM) with various concentrations of L-selectin were incubated in 10 µL of binding buffer for 30 min at 4 °C, followed by the addition of 2 µL of 10% glycerol. Subsequently, the samples were run on a 6% native-polyacrylamide gel for 40 min at 120 V at 4 °C. Images were acquired using the fluorescein scan settings on a Typhoon Trio imager (GE Healthcare Life Sciences, USA) and the resulting

bands

were

quantified

with

ImageQuant.

The

dissociation

constant,

Kd= ([Apt][Pro])/[Apt-Pro], was estimated using a non-linear least squares method on the function [Apt-Pro]/[Apt]total = [Pro]/([Pro]+Kd), where [Apt-Pro]/[Apt]total is the measured shifted fraction and [Pro] is the free L-selectin concentration. DMS

footprinting.

The

3’-end

FAM-labeled

Sgc-3b

(Sgc-3b-FAM)

(CTTATTCAATTCCCGTGGGAAGGCTATAGAGGGGCCAGTCTATGAATAAGTTTFAM) (100 nM) and L-selectin (300 nM) were incubated in a binding buffer at 4 °C for 30 min. Then, 4 µL of 10% (v/v) DMS solution was added and incubated for 2 min at room temperature. The DMS modification reaction was stopped by the addition of 100 uL of stop solution (0.6M sodium acetate pH 8.0, 0.1M beta-mercaptoethanol and 20 µg herring sperm DNA). After phenol-chloroform extraction and ethanol precipitation, the DNA was resuspended in 100 µL of 20% (v/v) piperidine solution, and heated at 90 °C for 30 min, followed by phenol-chloroform extraction and ethanol precipitation. The precipitated DNA was then resuspended in 30 µL of


5


Page 6 of 21

50% (v/v) deionized formamide in water, and was denatured at 95 °C for 5 min. The samples were resolved on a denaturing 12% polyacrylamide gel at 1000 V for 2 h. The images were acquired by Typhoon. Jurkat cells binding assay. FAM-labeled aptamer Sgc-3b, mutated sequences or optimized split aptamers were incubated with 3×105 Jurkat cells in 100 µL of binding buffer containing 1mg/mL BSA and 0.1 mg/mL herring sperm DNA at 4 °C for 30 min respectively. Cells were washed twice with 600 µL of binding buffer and resuspended in 300 µL of binding buffer. The fluorescence intensity of cells was then recorded by flow cytomerty. The equilibrium dissociation constants (Kd) of the aptamer-cell interaction were obtained by fitting the dependence of fluorescence intensity of specific binding on the concentration of the aptamers to the equation Y = Bmax X / (Kd + X), using GraphPad Prism 6 (San Diego, CA, USA). Split-aptamer-based cytometric bead assay and fluorescence imaging of the beads. FAMlabeled 3b-L (FAM-3b-L) (100 nM) and biotin-labeled 3b-S3 (biotin-3b-S3) (100 nM) were incubated with different concentrations of L-selectin in 50 µL of binding buffer containing 1mg/mL BSA and 0.1 mg/mL herring sperm DNA at 4 °C for 30 min. Then 2 µL of streptavidincoated microbeads were added and incubated for 30 min at room temperature. Subsequently, the microbeads were washed once and resuspended in 300 µL of binding buffer at room temperature for 20 min. The intensity of microbeads’ fluorescence was recorded by flow cytometry. All the experiments for binding assay were repeated three times. The microbeads were also imaged using an Olympus FV1000-IX81 confocal microscope. Green emission from carboxyfluorescein (FAM) was excited at 488 nm.


6

Page 7 of 21 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Human serum sample analysis. 2% of human serum samples were spiked with various concentrations of L-selectin. The concentration of L-selectin was detected using SACBA by the above-mentioned process and ELISA kit according to the manufacturer's protocol. RESULTS AND DISCUSSION Validation of Sgc-3b binding to soluble L-selectin. In previous research, we have generated an aptamer, Sgc-3b, which specifically binds to leukaemia cells (CCRF-CEM)2,

27-28

. The

molecular target of this aptamer was subsequently identified and validated to be L-selectin (CD62L) 27. L-selectin is a cell adhesion molecule expressed on leukocytes and endothelial cells. L-selectin is involved in leukocyte tethering and rolling during inflammation and tissue damage, and it also plays an important role in T cell effector functions and anti-tumor activity29. The extracellular domains of L-selectin can be shed in serum30. Monitoring the shed L-selectin (soluble L-selectin) levels in serum could evaluate the leukaemia relapse and be explored as potential prognostic disease biomarkers31. Currently, ELISA is the main method for the detection of shedding L-selectin in serum.


7


Page 8 of 21

. Figure 1. Electrophoresis mobility shift assay of the interaction of aptamer Sgc-3b and soluble L-selectin. (A) Native polyacrylamide gel electrophoresis (6%) image of Sgc-3b in the presence of soluble L-selectin, the concentrations of L-selectin are 0, 8, 15, 62, 115, 154, 231 and 308 nM. (B) Binding curve of L-selectin binding to Sgc-3b. To verify the binding ability of Sgc-3b to soluble L-selectin in vitro, we measured its Kd by electrophoresis mobility shift assay (Figure 1A). As shown in Figure1A, with the increase of Lselectin, the bound aptamer increased rapidly. The Kd was calculated to be 5.8 ± 0.9 nM according to the greyscale of Sgc-3b/L-selectin complex (Figure 1B). The Kd of Sgc-3b to Lselectin anchored on Jurkat cell surface was also measured by flow cytometry to be 1.0 ± 0.5 nM (Figure S1). Although the Kd of Sgc-3b to soluble L-selectin was a little higher than that to anchored L-selectin, it was still in the low nanomolar range, suggesting the high affinity of Sgc3b to soluble L-selectin.


8

Page 9 of 21 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Binding structure investigation and splitting of aptamer sgc-3b. Sgc-3b was predicted to fold into a joined three-way helix structure32. For the sake of discussion, we partitioned this structure into four regions, stem I, stem II, hairpin III and bulge (Figure 2A). To deeply understand the binding site of aptamer Sgc-3b, we conducted a DMS footprinting experiment, which revealed the involvement of specific guanine residues of DNA in protein binding by measuring the susceptibility of the N7 of guanine to methylation by dimethylsulfate33-34. As shown in Figure 2B, in the absence of L-selectin, all guanine were methylated (lane 1). Interestingly, in the presence of L-selectin, G22, G29, G31, G32, G34 and G38 were found to be protected and G23 was found to be hypersensitive to DMS methylation (lane 2). This result suggested that the protected guanines were involved in the binding to L-selectin, i.e. the hairpin III and bulge regions were the binding areas of Sgc-3b to L-selectin. Stem I and stem II regions may not have been involved in directly binding to L-selectin and mainly played the role of maintaining the binding structure.


9


Page 10 of 21

Figure 2. (A) Proposed secondary structure of aptamer Sgc-3b. (B) DMS footprinting assay of Sgc-3b-FAM in the presence or absence of L-selectin on 20% denaturing-polyacrylamide gel. Lane 1, only Sgc-3b-FAM; lane 2, Sgc-3b-FAM + L-selectin. (C) The binding of FAM-labeled mutated sequences on Jurkat cells. In order to prove above hypothesis, we performed a mutation assay. After mutation of the protected guanine with A or T respectively (3b-22G, 3b-23G, 3b-29G, 3b-3132G, 3b-33G, 3b34G, 3b-38G) (Table S1), the binding abilities of all these mutated sequences were lost or greatly decreased (Figure 2C), indicating that those guanine were essential for L-selectin binding. However, when replacing G50 of stem I, G15 or G17 of stem II with A respectively (3b-50G, 3b15G, 3b-17G), the mutated sequences still bound to L-selectin. When replacing G18G19 with AA to form two base mismatched stem II, the binding ability of the mutated sequence (3b-1819G) greatly decreased; but when replacing G18G19 with TT and C12C13 with AA to form a perfectmatched stem II (3b-1819AT), the binding was restored. Furthermore, when replacing the whole stem I and stem II with two new stems, the new sequence (3b-D) still had high binding ability to L-selectin (Figure S2). These results confirmed that L-selectin bound to the domain formed by hairpin III and bulge, and stem I and II played the role of stabilizing the binding structure. Since the above results confirmed that stem I and stem II mainly maintained the binding structure and did not directly bind to L-selectin, we supposed that the sequence that composed both stems might be separated. Therefore, we cut aptamer Sgc-3b into two parts between G15 and T16 (Figure 2A). The longer part containing the binding region was labeled with FAM at its 5’end (FAM-3b-L) and the shorter part was named 3b-S. 3b-L could not bind to L-selectin highly expressed cells (Jurkat cells), suggesting the loss of binding structure. But 3b-L bound to the Jurkat cells together with 3b-S with the apparent Kd of 3.5 ± 0.9 nM (Figure S3A), suggesting


10

Page 11 of 21 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


that 3b-S, 3b-L and L-selectin formed a ternary complex. Gradually truncating the 3’-end of 3b-S (3b-S-13 and 3b-S-11) caused the decrease of the binding ability of the split aptamers (Figure S3B), confirming that stem II was essential for maintaining the binding structure. This result suggested the good efficiency of the split aptamer against L-selectin consisted of 3b-S and 3b-L. Rational design of split aptamer for cytometric bead assay. Based on the fact that two moieties of a split aptamer formed a ternary complex with its target, we designed a SACBA method for soluble L-selectin, which was essentially a sandwich sorbent assay. The principle of this assay is shown in Scheme 1: the dye-labeled longer moiety of the split aptamer served as a signaler, and the biotin-labeled shorter moiety served as a capture sequence immobilized on beads through the interaction of biotin and streptavidin; both moieties were carefully designed so that the dye-labeled moiety could not bind the biotin labeled one in the absence of the target; only in the presence of the target, they formed a ternary complex and were captured by streptavidin-coated microbeads. The fluorescence intensity on beads measured by flow cytometry (FCM) reflected the concentration of targets.


11


Page 12 of 21

Figure 3. (A) The binding of split aptamer consisted of FAM-3b-L and different 3b-S derivatives to Jurkat cells. (B) Flow cytometry assay of streptavidin coated beads after incubation with FAM-3b-L and biotin-3b-S or biotin-3b-S3 in the presence or absence of soluble L-selectin. Because in the absence of L-selectin, 3b-L could weakly bind to 3b-S through the formation of duplex (stem I and stem II), which resulted in strong background fluorescence (Figure 3B). In order to inhibit the unwanted binding of 3b-L and 3b-S, four nucleotides and six nucleotides were first added to the 5’-end of 3b-S respectively to form a hairpin structure (3b-S-4p, 3b-S-6p) (Table S2). However, the binding ability of the split aptamer (FAM-3b-L+ 3b-S-4p or 3b-S-6p) to Jurkat cells greatly decreased (Figure 3A), implying that the hairpin structures were too stable


12

Page 13 of 21 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


to be opened by L-selectin and 3b-L through the formation of a ternary complex. Toeholdmediated strand displacement reaction is often used to trigger the response of a DNA probes or device35-36. Therefore, we further designed sequences 3b-S6, 3b-S4 and 3b-S3 by adding five nucleotides at the 5’-end of 3b-S. The 5’-end of these new sequences complemented with their middle part by six, four and three nucleotides respectively to form a hairpin with an overhanging toehold (Figure S4). The binding assay showed that the split aptamer consisted of 3b-S3 and 3bL displayed the highest binding ability to the Jurkat cells (Figure 3A), suggesting that the anchored L-selectin on cells effectively induced the split aptamer to form the binding structure and bound onto cells. To investigate the response of SACBA to soluble L-selectin, we labeled biotin on the 5’-end of 3b-S and 3b-S3 (Table S2) through an A4 spacer, and then incubated them with FAM-3b-L respectively in the presence or absence of L-selectin. The reaction mixtures were then incubated with streptavidin-coated microbeads and finally applied to flow cytometry assay after washing. As shown in Figure 3B, in the absence of L-selectin, the fluorescence intensity of streptavidincoated microbeads incubated with biotin-3b-S3 and FAM-3b-L was almost the same as that incubated with FAM-3b-L only, and was lower than that incubated with biotin-3b-S and FAM3b-L, suggesting the background fluorescence derived from the self-assembly of biotin-3b-S3 and FAM-3b-L was greatly reduced. In the presence of L-selectin, the fluorescence intensity of streptavidin-coated microbeads incubated with biotin-3b-S3 and FAM-3b-L was very similar with that incubated with biotin-3b-S and FAM-3b-L, and much higher than that incubated in the absence of L-selectin. These results suggested that the soluble L-selectin induced the biotin-3bS3 and FAM-3b-L to form a sandwich complex and was captured by streptavidin-coated microbeads. Compared with biotin-3b-S, the extended sequence on 3b-S3 did not influence the


13


Page 14 of 21

binding ability of the split aptamer. Therefore 3b-S3 and 3b-L was chosen as the optimized split aptamer for the further investigation. Detection of soluble L-selectin by SACBA. In order to test the feasibility using SACBA for detecting the soluble L-selectin, different concentrations of L-selectin were incubated with FAM3b-L and biotin-3b-S3, and then added with streptavidin-coated uniform-size PS microbeads. As shown in Figure 4A, the fluorescence intensity of the microbeads increased gradually with the increase of L-selection and reached a plateau at a concentration of 135 nM. A linearity was obtained in the range of 1.1-16.9 nM with a correlation coefficient 0.9893 (Figure 4A, inset). The detection limit was calculated to be 12 pM based on three times the signal-to-noise ratio. This result indicated that this novel split aptamer cytometric sensor could detect soluble L-selectin with a high sensitivity. In addition, the fluorescence alteration of the microbeads with the concentration of L-selection was observed by confocal microscopy imaging, which also proved the efficiency of this strategy (Figure 4C) and suggesting the possibility of the semi-quantitative analysis of L-selection by visual assessment. To investigate the selectivity of this method, five other common proteins were analyzed by the same process. The concentration of these proteins was 300-fold higher than L-selectin. Flow cytometry assay (Figure 4B) and fluorescence confocal microscopy imaging (Figure S5) showed that only L-selectin caused strong fluorescence on beads, while other proteins, such as thrombin, α-chymotrypsin, hemoglobin, transferrin and human albumin, resulted in very weak fluorescence, suggesting the excellent selectivity of the proposed method for L-selectin detection.


14

Page 15 of 21 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. (A) Plot of fluorescence intensity versus L-selectin concentration (1.1, 2.1, 4.2, 8.5, 16.9, 33.8, 67.7, 135.4, 270.8 nM). Inset: Linear fitting curve. (B) Selectivity of the assay for Lselectin over thrombin, α-chymotrypsin, hemoglobin, transferrin and human albumin. The concentration of L-selectin is 30.0 nM, others are 10.0 µM. (C) Fluorescence confocal microscopy images of microbeads after incubated with 0, 8.0, 16.0 nM L-selectin and 10.0 µM human albumin. To demonstrate the practical applicability of SACBA in real samples, the detection of free Lselectin in human serum was conducted. A sample of 2% human serum was spiked with different concentrations of L-selectin and incubated with FAM-3b-L and biotin-3b-S3. The microbeads’ fluorescence was measured by flow cytometry. Good recoveries were obtained in three spikes levels. When serum samples were spiked with 4.9, 11.7, 23.2 nM L-selectin, recoveries were


15


Page 16 of 21

109.4%, 100.2% and 104.1% respectively, which were consistent with the results measured by ELISA (Table 1). These results suggest that SACBA is a well-behaved strategy for detection of L-selectin in real serum samples. Importantly, the cost of SACBA per assay is less than one percent of ELISA; and the time consumption of SACBA is about 2 h instead of overnight in ELISA. Table 1. Determination of soluble L-selectin spiked in human serum (n=3). L-selectin spiked (nM)

ELISA

SACBA

Found (nM)

Recovery (%)

Found (nM)

Recovery (%)

4.9

5.1±0.5

104.2±4.6

5.3±0.1

109.4±0.4

11.8

11.9±0.1

101.0±2.7

11.8±0.5

100.2±4.5

23.3

24.6±0.1

105.7±1.1

24.2±0.1

104.1±2.0

Through DMS footprinting and mutation assay, we have elucidated the roles of each part of Sgc-3b in the target binding. Based on the thorough understanding of the binding structure of Sgc-3b, we have designed a split aptamer by separating the duplex strand that served as a stabilizer of the binding structure and remaining target-binding area. Since aptamers bind their target through the tertiary structure formed by intramolecular interaction, and their binding sites are usually stabilized by intramolecular duplexes, this method for the design of a split aptamer may be applied to other aptamers. To date, hundreds of aptamers have been generated. With the development of the structure investigation of aptamers, more and more split aptamers will be designed and engineered. Compared with the common sandwich-immunoassay, the split-aptamer-based assay only used one split aptamer instead of the capturing antibody and the signaling antibody. Because aptamers


16

Page 17 of 21 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


possess high stability at room temperature, as well as high reproducibility in chemical synthesis and modification; the split-aptamer-based assay would be much cheaper and has far fewer errors resulting from the reagent quality. Aptamer can be generated routinely in vitro by the SELEX technique against various targets, including small molecules, proteins, cells or even tissues37. Because small-molecule targets can induce split aptamer to form a ternary complex, the same mechanism as protein targets, this SACBA method can be easily expanded to the detection of small molecules. CONCLUSIONS In summary, we have figured out the target-binding moiety and the structure-stabilizing moiety of the L-selectin-binding aptamer, Sgc-3b. Based on the structure, we have designed a split aptamer for L-selection, and then further developed a novel, rapid SACBA method for detection of soluble L-selection through design of the split sequence to eliminate the nonspecific binding. The SACBA shows high sensitivity, which has a linear range of 1.1-16.9 nM with a low detection limit of 12 pM. Meanwhile, the SACBA has good selectivity to L-selectin over other proteins. SACBA has been successfully applied for determination of soluble L-selectin spiked in human serum samples. The strategy for rational design of the split aptamer is convenient and efficient. The SACBA is rapid, simple and cost efficient, which shows the potential in detection of various targets, such as proteins and small molecules. ASSOCIATED CONTENT Supporting Information. The Supporting Information is available free of charge on the ACS Publications website at DOI:


17


Page 18 of 21

Mutated Oligonucleotides Sequences; truncated Oligonucleotides Sequences of 3b-S; the binding curve of aptamer Sgc-3b to Jurkat cells; proposed secondary structure of 3b-D; binding curve of split aptamer FAM-3b-L/3b-S and the binding of 3b-S truncated split aptamer to Jurkat cells; structure of the designed sequences of 3b-S; fluorescence confocal microscopy images of microbeads after incubated with non-target proteins and L-selectin.

AUTHOR INFORMATION Corresponding Author * Correspondence author. Tel/Fax:86-10-62528509; Email: [email protected] (D. Shangguan), [email protected] (T. Bing) Author Contributions The manuscript was written through contributions of all authors. All authors have given approval to the final version of the manuscript. ACKNOWLEDGMENT The authors gratefully acknowledge the financial support from NSF of China (21635008, 21535009, 21575147, 21375135 and 21621062). REFERENCES (1) Tuerk, C.; Gold, L. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 1990, 249, 505-510.


18

Page 19 of 21 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(2) Shangguan, D.; Li, Y.; Tang, Z.; Cao, Z. C.; Chen, H. W.; Mallikaratchy, P.; Sefah, K.; Yang, C. J.; Tan, W. Aptamers evolved from live cells as effective molecular probes for cancer study. Proc. Nat. Acad. Sci. U.S.A. 2006, 103, 11838-11843. (3) Ellington, A. D.; Szostak, J. W. In vitro selection of RNA molecules that bind specific ligands. Nature 1990, 346, 818-822. (4) Zhu, Z.; Song, Y.; Li, C.; Zou, Y.; Zhu, L.; An, Y.; Yang, C. J. Monoclonal surface display SELEX for simple, rapid, efficient, and cost-effective aptamer enrichment and identification. Anal. Chem. 2014, 86, 5881-5888. (5) Nimjee, S. M.; Rusconi, C. P.; Sullenger, B. A. Aptamers: an emerging class of therapeutics. Annu. Rev. Med. 2005, 56, 555-583. (6) Sun, H.; Zhu, X.; Lu, P. Y.; Rosato, R. R.; Tan, W.; Zu, Y. Oligonucleotide aptamers: new tools for targeted cancer therapy. Mol. Ther-Nucl. Acids 2014, 3, 11959-11980. (7) Deng, B.; Lin, Y.; Wang, C.; Li, F.; Wang, Z.; Zhang, H.; Li, X. F.; Le, X. C. Aptamer binding assays for proteins: the thrombin example--a review. Anal. Chim. Acta. 2014, 837, 1-15. (8) Chen, A.; Yan, M.; Yang, S. Split aptamers and their applications in sandwich aptasensors. Trends Anal. Chem. 2016, 80, 581-593. (9) Mei, H.; Bing, T.; Qi, C.; Zhang, N.; Liu, X.; Chang, T.; Yan, J.; Shangguan, D. Rational design of Hg2+ controlled streptavidin-binding aptamer. Chem. Commun. 2013, 49, 164-166. (10) Liang, L.; Su, M.; Li, L.; Lan, F.; Yang, G.; Ge, S.; Yu, J.; Song, X. Aptamer-based fluorescent and visual biosensor for multiplexed monitoring of cancer cells in microfluidic paper-based analytical devices. Sensor. Actuat. B-Chem. 2016, 229, 347-354. (11) Fang, X.; Tan, W. Aptamers Generated from Cell-SELEX for Molecular Medicine: A Chemical Biology Approach. Accounts Chem. Res. 2010, 42, 48-57. (12) Kuai, H.; Zhao, Z.; Mo, L.; Liu, H.; Hu, X.; Fu, T.; Zhang, X.; Tan, W. Circular Bivalent Aptamers Enable in Vivo Stability and Recognition. J. Am. Chem. Soc. 2017, 139, 9128-9131. (13) Sun, N.; Wang, J.; Ji, L.; Hong, S.; Dong, J.; Guo, Y.; Zhang, K.; Pei, R. A Cellular Compatible Chitosan Nanoparticle Surface for Isolation and In Situ Culture of Rare Number CTCs. Small 2015, 11, 5444-5451. (14) Li, J.; Mo, L.; Lu, C. H.; Fu, T.; Yang, H. H.; Tan, W. Functional nucleic acid-based hydrogels for bioanalytical and biomedical applications. Chem. Soc. Rev. 2016, 45, 1410-1431. (15) Lau, P. S.; Li, Y. Exploration of Structure-Switching in the Design of Aptamer Biosensors. In Biosensors Based on Aptamers and Enzymes; Springer: 2013; pp 69-92. (16) Mun, H.; Jo, E.-J.; Li, T.; Joung, H.-A.; Hong, D.-G.; Shim, W.-B.; Jung, C.; Kim, M.-G. Homogeneous assay of target molecules based on chemiluminescence resonance energy transfer (CRET) using DNAzyme-linked aptamers. Biosens. Bioelectron. 2014, 58, 308-313. (17) Stojanovic, M. N.; De Prada, P.; Landry, D. W. Aptamer-based folding fluorescent sensor for cocaine. J. Am. Chem. Soc. 2001, 123, 4928-4931. (18) Zhao, T.; Liu, R.; Ding, X.; Zhao, J.; Yu, H.; Wang, L.; Xu, Q.; Wang, X.; Lou, X.; He, M.; Xiao, Y. Nanoprobe-Enhanced, Split Aptamer-Based Electrochemical Sandwich Assay for Ultrasensitive Detection of Small Molecules. Anal. Chem. 2015, 87, 7712-7719. (19) Yuan, B.; Sun, Y.; Guo, Q.; Huang, J.; Yang, X.; Chen, Y.; Wen, X.; Meng, X.; Liu, J.; Wang, K. High Signal-to-Background Ratio Detection of Cancer Cells with Activatable Strategy Based on Target-Induced Self-Assembly of Split Aptamers. Anal. Chem. 2017, 89, 9347-9353. (20) Kent, A. D.; Spiropulos, N. G.; Heemstra, J. M. General approach for engineering smallmolecule-binding DNA split aptamers. Anal. Chem. 2013, 85, 9916-9923.


19


Page 20 of 21

(21) Chen, J.; Zhang, J.; Li, J.; Yang, H. H.; Fu, F.; Chen, G. An ultrasensitive signal-on electrochemical aptasensor via target-induced conjunction of split aptamer fragments. Biosens. Bioelectron. 2010, 25, 996-1000. (22) Liu, X.; Bing, T.; Shangguan, D. Microbead-Based Platform for Multiplex Detection of DNA and Protein. ACS Appl. Mater. Interfaces 2017, 9, 9462-9469. (23) Frengen, J.; Schmid, R.; Kierulf, B.; Nustad, K.; Paus, E.; Berge, A.; Lindmo, T. Homogeneous immunofluorometric assays of alpha-fetoprotein with macroporous, monosized particles and flow cytometry. Clin. Chem. 1993, 39, 2174-2181. (24) Vignali, D. A. Multiplexed particle-based flow cytometric assays. J. Immunol. Methods 2000, 243, 243-255. (25) Kellar, K. L.; Iannone, M. A. Multiplexed microsphere-based flow cytometric assays. Exp. Hematol. 2002, 30, 1227-1237. (26) Soler, M.; Estevez, M. C.; Alvarez, M.; Otte, M. A.; Sepulveda, B.; Lechuga, L. M. Direct Detection of Protein Biomarkers in Human Fluids Using Site-Specific Antibody Immobilization Strategies. Sensors-Basel 2014, 14, 2239-2258. (27) Bing, T.; Shangguan, D.; Wang, Y. Facile discovery of cell-surface protein targets of cancer cell aptamers. Mol. Cell. Proteomics 2015, 14, 2692-2700. (28) Shangguan, D.; Tang, Z.; Mallikaratchy, P.; Xiao, Z.; Tan, W. Optimization and modifications of aptamers selected from live cancer cell lines. Chembiochem 2007, 8, 603-606. (29) Yang, S.; Liu, F.; Wang, Q. J.; Rosenberg, S. A.; Morgan, R. A. The shedding of CD62L (L-selectin) regulates the acquisition of lytic activity in human tumor reactive T lymphocytes. Plos One 2011, 6, e22560. (30) Gifford, J. L.; Ishida, H.; Vogel, H. J. Structural insights into calmodulin-regulated Lselectin ectodomain shedding. J. Biol. Chem. 2012, 287, 26513-26527. (31) Zonneveld, R.; Martinelli, R.; Shapiro, N. I.; Kuijpers, T. W.; Plotz, F. B.; Carman, C. V. Soluble adhesion molecules as markers for sepsis and the potential pathophysiological discrepancy in neonates, children and adults. Crit. Care 2014, 18, 204-218. (32) Zuker, M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 2003, 31, 3406-3415. (33) Sen, D.; Gilbert, W. Formation of parallel four-stranded complexes by guanine-rich motifs in DNA and its implications for meiosis. Nature 1988, 334, 364-366. (34) Boese, B. J.; Breaker, R. R. In vitro selection and characterization of cellulose-binding DNA aptamers. Nucleic Acids Res. 2007, 35, 6378-6388. (35) Monserud, J. H.; Macri, K. M.; Schwartz, D. K. Toehold-Mediated Displacement of an Adenosine-Binding Aptamer from a DNA Duplex by its Ligand. Angew. Chem. Int. Ed. 2016, 55, 13710-13713. (36) Wang, X. Y.; Zou, M. J.; Huang, H. D.; Ren, Y. Q.; Li, L. M.; Yang, X. D.; Li, N. Gold nanoparticle enhanced fluorescence anisotropy for the assay of single nucleotide polymorphisms (SNPs) based on toehold-mediated strand-displacement reaction. Biosens. Bioelectron. 2013, 41, 569-575. (37) Liu, J.; Cao, Z.; Lu, Y. Functional Nucleic Acid Sensors. Chem. Rev. 2009, 109, 1948-1998.

For TOC


20

Page 21 of 21 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60



21

Flow cytometric bead sandwich assay based on split aptamer - ACS

Recommend Documents