Identification of a filamin A mechanobinding partner II: Fimbacin is a

Subscriber access provided by UNIV OF LOUISIANA

Article

Identification of a filamin A mechanobinding partner II: Fimbacin is a novel actin-crosslinking and filamin A binding protein Jiale Wang, and Fumihiko Nakamura Biochemistry, Just Accepted Manuscript • DOI: 10.1021/acs.biochem.9b00101 • Publication Date (Web): 16 Apr 2019 Downloaded from http://pubs.acs.org on April 17, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 17 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Identification of a filamin A mechanobinding partner II: Fimbacin is a novel actin-crosslinking and filamin A binding protein Jiale Wang and Fumihiko Nakamura* From School of Pharmaceutical Science and Technology, Life Science Platform, Tianjin University, 92 Weijin Road, Nankai District, Tianjin, 300072, China * To whom correspondence should be addressed: Fumihiko Nakamura: School of Pharmaceutical Science and Technology, Life Science Platform: [email protected]; Tel: +86- 22-87401830 ABBREVIATIONS FLNA, filamin A； FRAP, fluorescent recovery after photobleaching; CC, coiled-coil; IB, immunoblotting; IP, immunoprecipitation; LUZP1, leucine zipper protein 1; F-actin, actin filaments; SILAC, stable isotope labeling by amino acids in cell culture

1

ACS Paragon Plus Environment

Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT Filamin A (FLNA), an actin cross-linking protein, acts as a mechanosensor and -transducer by exposing the cryptic binding site on repeat 21 (R21) to interact with integrin. Here, we investigated if any other biological molecule interacts with the cryptic binding site. Using proteomics and in silico screening for a FLNA-binding motif, we identified and characterized a protein termed fimbacin (filamin mechanobinding actin crosslinking protein), encoded in the LUZP1 gene, as a novel FLNA-binding partner. Fimbacin does not interact with canonical full-length FLNA, but the exposure of a cryptic integrinbinding site of FLNA R21 enables fimbacin to interact. We have identified two FLNA binding sites on fimbacin and determined critical amino acid residues for the interaction. We also found that fimbacin itself is a new actin-crosslinking protein and mapped the actinbinding site on amino acid residues 400-500. Fimbacin oligomerizes (estimated as an octamer on size-exclusion chromatography) through the amino-terminal domain that is predicted to be a coiled-coil to crosslink actin filaments. When expressed, fimbacin localized to actin stress fibers in tissue culture cells. Although the interaction with FLNA is not necessary for fimbacin to colocalize with F-actin, fluorescent recovery after photobleaching (FRAP) revealed that their interaction stabilizes fimbacin on the actin cytoskeleton and inhibition of Rho-kinase, an upstream activator of myosin II, also decreases the interaction presumably due to loss of internal mechanical stress. Taken together, these data identify fimbacin as a new actin-crosslinking protein that interacts with the FLNA mechanosensing domain R21.

2


Page 2 of 17

Page 3 of 17 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

INTRODUCTION Our accompanying report described that a LUZP1 gene product is a potential novel FLNA-mechanobinding partner [ref. Identification of a filamin A mechanobinding partner I: Smoothelin specifically interacts with filamin A mechanosensitive domain 21]. Human LUZP1 is a 1076 amino acid protein with multiple spliced isoforms. The gene encoding LUZP1 maps to human chromosome 1 1 and 1p36 deletions that include LUZP1 causes cardiovascular malformations and cardiomyopathy 2. In mice, Luzp knockout results in failure of cranial neural tube closure with exposed brain tissues and cardiovascular defects 3. Although LUZP1 was reported to be predominantly expressed in the brain 1, 4, its mRNA is widely expressed in tissues (http://bioinfo.wilmer.jhu.edu/tiger/). LUZP1 protein contains three leucine zipper motifs and coiled-coil domain at its amino terminus, but biochemical characterization of LUZP1 has never been performed. Here we report the identification and characterization of a novel filamin binding and actin cross-linking protein designated as fimbacin, filamin mechanobinding actin crosslinking protein, encoded by the LUZP1 gene. We demonstrated that fimbacin interacts with the cryptic integrinbinding site of FLNA R21, that can be exposed by physiologically relevant forces 5-7 and identified critical amino acid residues for their interaction. We also showed that fimbacin colocalizes with FLNA and actin filaments (F-actin) in cells. Deletion of the FLNA-binding sites and inhibition of Rho-kinase alter the dynamics of fimbacin in living cells. Furthermore, we showed that fimbacin is a novel actin-crosslinking protein that mapped actin-binding domain. EXPERIMENTAL PROCEDURES Antibodies Rabbit polyclonal anti-LUZP1 (fimbacin) antibodies were purchased from Proteintech Group Inc (Fisher Scientific) and used for western blotting (1:1000) and immunofluorescence (1:200). Plasmid construction Human LUZP1 cDNA (UniProt Accession ID Q86V48) was amplified by PCR using 5’ primer GAAGATCTATGGCCGAATTTACAAGCTACAAG, 3’ primer ACGCGTCGACTTAGCTGCTCATGCTTGCTGAGTG, and qPCR human reference cDNA (Clontech) as a template and ligated into a pAcGFP-C1 (Clontech) vector at the BglII/SalII sites. The DNA sequence analysis confirmed that the cloned cDNA encoded LUZP1 isoform 2 (1026 amino acid residues, Q86V48-2). The cDNA encoding LUZP1 isoform 2 was also amplified by PCR using 5’ primer, GAAGATCTATGGCCGAATTTACAAGCTACAAG, containing a BglII site, and 3’ primer, GCTAGCGGCCGCGCTGCTCATGCTTGCTGAG, containing NotI site, digested with BglII/NotI, and ligated into BamHI/NotI sites of pcDNA3.6-Myc or eGFP to construct pcDNA3.6-LUZP1-Myc or pcDNA3.6-LUZP1-eGFP, respectively. Deletion mutants were engineered using the QuickChange® site-directed mutagenesis kit. pET23-HTb was constructed by PCR. Briefly, cDNA encoding Halo-tag was amplified by PCR using pFN21A HaloTag® CMV Flexi® Vector (Promega) as the template, the forward primer, CATGCCATGGCAGAAATCGGTACTGG, containing a NcoI site, and the reverse

3


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

primer, GCGGATCCTCCACCGGAAATCTCCAGAGTAGACAGCCAGCGCGCGATC, containing BamHI site. The amplified fragments were purified, NcoI/BamHIdigested, and ligated into NcoI/BamHI sites in the pET-23a(+)-HTb vector 8 to generate pET-23a(+)-HTb-Halo. In the same fashion, pET23HTb-EGFP was generated by inserting EGFP cDNA after HT (His-tag). For bacterial expression, fragments of LUZP1 were amplified by PCR and ligated into pGEX4T-1 (GE Healthcare), pGEX4T-HTb9, pET23-HTb8, pET23HTb-EGFP, and pET23-HTb-Halo vector. Recombinant protein expression in bacteria and purification Bacteria protein expression vectors were transformed into OverExpressTM C41(DE3) chemically competent cells (Lucigen). Protein expression was induced with 4mM IPTG at the 37℃ using shaker incubator at 250rpm. Protein was purified using affinity resin in accordance with manufactures’ instructions followed by ion exchange (Bio-ScaleTM Mini Micro-Prep® High Q Cartridges, 5mL, Bio-rad) and sizeexclusion (ErichTM SEC 650 10X300 column, 24mL, Bio-rad) chromatography. F-actin bundling assay Purified fimbacin fragments (0.5 μM) were mixed with G-actin (10 μM) in the presence of polymerization buffer (20mM Tris-HCl, pH7.4, 100mM KCl, 2mM MgCl2, 0.2 mM CaCl2, 0.5mM ATP) containing Alexa Fluor 568 phalloidin (0.03 μM=1 unit/ml). F-actin binding assay Purified His-EGFP-fimbacin fragments (5 μM) were coated on 10 μl of NiNTA in 400 μl of polymerization buffer. After washing unbound protein, the beads were incubated with actin (10 μM) for 1 hr at 4℃. The beads were washed two times with polymerization buffer and bound proteins were eluted with SDS sample buffer. Bound actin was detected by western blotting using rabbit polyclonal anti-actin antibodies (BA0410, Boster, China). Size exclusion chromatography Oligomerization status of fimbacin fragment (1-360 amino acid residues) was assessed on Superdex 200 and Superose 6 size exclusion chromatography column (10/300 GL, GE Healthcare) equilibrated with PBS containing 1 mM EGTA and 1 mM β-mercaptoethanol by using an AKTA FPLC system (GE Healthcare). Gel filtration calibration kit (GE Healthcare) was used as a protein standard. Cell culture and transfection Cell lines HEK 293A (Invitrogen), Mouse embryonic fibroblast (MEF, American Type Culture Collection), and Hela cells were maintained in DMEM (Invitrogen) supplemented with 10% FBS. HEK 293A, Hela, and MEF cells were transfected using Trans-IT LT1, HeLaMONSTER, Trans-IT X2 Dynamic Delivery System (Mirus Bio), respectively.

4


Page 4 of 17

Page 5 of 17 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Other materials and methods are described in the accompanied paper [ref. Identification of a filamin A mechanobinding partner I: Smoothelin specifically interacts with filamin A mechanosensitive domain 21]. RESULTS Identification of fimbacin as a new FLNA binding partner To test if fimbacin directly interacts with FLNA, we co-expressed GFP-fimbacin with WT and mutant FLAG-FLNA in HEK-293 cells. GFP-fimbacin was co-immunoprecipitated with FLNA variant-1 (FLNAvar-1 lacks 41 amino acid residue that include strand A of FLNA R20, thereby exposing integrin-binding site of R21), but not with WT and point mutant FLNA (Figure 1). Immunofluorescence microscopy demonstrated that fimbacin colocalizes with FLNA and F-actin in Hela and MEF cells (Figures 1B and S1). Manders’ overlap coefficients were calculated to quantify the extent of the colocalization of fimbacin with FLNA (0.963±0.02) and actin filaments (0.973±0.03). Since the overlap coefficient will vary from 0 (no colocalization) to 1 (100% colocalization), fimabacin highly colocalizes with FLNA and F-actin.

Figure 1. Interaction of fimbacin with FLNA. (A) Co-immunoprecipitation of GFP-fimbacin with open (del 41) FLAG-FLNA expressed in HEK-293 cells. Bound AcGFP-fimbacin was detected by immunoblotting using anti-GFP antibodies. Note that fimbacin does not co-precipitated with WT and point mutant FLAG-FLNA. (B) Colocalization of fimbacin with FLNA and F-actin in Hela cells. Immunofluorescence microscopy was performed using rabbit anti-fimbacin, mouse anti-FLNA, and Alexa 568 phalloidin (F-actin). bar=50μm. Manders’ overlap coefficients were calculated using ImageJ

5


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

plug-in, JACoP. 0.963±0.02 (Fimbacin/Factin, n=5).

(Fimbacin/FLNA,

Page 6 of 17

n=5)

and

0.973±0.03

To map a FLNA-binding site of fimbacin, we expressed deletion mutants of fimbacin as GST fusion protein and incubated the GST fusion proteins coated on glutathione beads with purified GFP-R21. Bound R21 was detected by western blotting using anti-GFP (Figure 2). We identified two FLNA-binding sites on fimbacin between 833 and 883 amino acid residues.

6


Page 7 of 17 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

GST-fimbacin fragments MW

MW

MW

MW 250 150

250 150

250 150

250 150

100

100

100

100

75

75

75

75

50

50

50

50

37

37

37

37

25

25

25

25

1

2

3

4

5

6

7

8

9

10

11

12

13

14

15

16

Bound GFP-R21 (Anti-GFP)

1

2

3

4

5

6

7

8

9

10

11

12

13

14

15

16

Figure 2. Structure of one of fimbacin isoforms (isoform 2) and identification of FLNA-binding sites on fimbacin. (A) Summary of FLNAbinding experiments. The binding data are shown in supplementary Figure 1. CC:coiled-coil. Three leucine zipper motifs are located in the CC domain predicted by computational analysis. (B) FLNA-binding sites are identified at 833-883 amino acid residues of fimbacin. (C) CBB stained gel of GST-fimbacin constructs (top) and western blotting against GFP-R21 bound to GST-fimbacin fragments (bottom). Lane 1(548727aa), 2(728-927), 3(928-1026), 4(1-497), 5(497-547), 6(728-778), 7(779-838), 8(839-927), 9(779-868), 10(869-927), 11(884-927), 12(779905), 13(779-842), 14(779-849), 15(779-855), and 16(779-861). These two FLNA-binding sites contain typical FLNA-binding motif and deletion of the motifs or point mutations of the critical amino acid residues abolished FLNA-binding (Figure 3). Sequence alignment of fimbacin expressed in different species revealed that FLNA-binding domains are highly conserved (Figure S2).

7


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 3. Determination of FLNA-binding site of fimbacin. (A) Alignment of binding interfaces of FLNA-binding partners predicts that point mutations of V838A, S840A, V873A, and S875A should abolish FLNA-fimbacin interaction. (B) Deletion of the FLNA-binding domain (833-883 amino acid residues) or point mutations of VS/AA (V838A, S840A, V873A, and S875A) disrupts FLNA-fimbacin interaction. Co-immunoprecipitation of GFPfimbacin with open (del 41) FLAG-FLNA expressed in HEK-293 cells. Bound AcGFP-fimbacin was detected by immunoblotting using anti-GFP antibodies. Fimbacin is a novel F-actin cross-linking protein To characterize fimbacin protein in living cells, we constructed mammalian expression vectors that carry human fimbacin fused with three different tags at different locations (Figure S3). All three constructs colocalized with F-actin in agreement with immunostaining (Figures 1 and S4). Unexpectedly, deletion of FLNA-binding site did not affect colocalization of fimbacin with F-actin (Figures S4), suggesting that fimbacin directly or indirectly binds to F-actin without FLNA-binding. To test if fimbacin protein directly interacts with F-actin, we attempted to express full-length fimbacin in bacteria and insect cells, but failed. Therefore, we constructed various deletion mutants of fimbacin tagged with eGFP and expressed them in MEF cells to identify amino acid residues responsible for F-actin colocalization (Figure 4 and Figure S5).

8


Page 8 of 17

Page 9 of 17 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

Figure 4. Identification of F-actin binding domain of fimbacin. Fimbacin fragments tagged with eGFP was expressed in MEF cells and stained with phalloidin-Alexa568. Bar=50μm. Note that full-length fimbacin exclusively localized on actin stress fibers (Overlap coefficients: 0.951±0.017). The N-terminal fragment 1-500 (Overlap coefficients: 0.909±0.039) still colocalizes on stress fiber, whereas 1-400 (Overlap coefficients: 0.829±0.014) does not, suggesting that F-actin binding site locates on residue 400-500. See also Supplementary Figure S5. The results demonstrated that residues 400 to 500 of fimbacin are necessary for F-actin binding, but not sufficient as fimbacin 360-729 does not fully colocalize with F-actin (Figure S5). Next we investigated if fimbacin residues 1-500 have the ability to cross-link F-actin in vitro as these residues co-localize actin stress fibers in vivo. We attempted to express fimbacin 1-500 in bacteria expression system using different monomeric tags including His, His-EGFP, and His-Halo but only His-Halo-fimbacin 1-500 was expressed and partially purified (Figure 5). Polymerization of actin in the presence of His-Halo-fimbacin 1-500 formed bundling of F-actin, whereas 1-360 did not. These data demonstrated for the first time that fimbacin is an actin cross-linking protein (Figure 5). The results suggest that the N-terminal residues 1-359, which contains predicted coiled-coil (CC) domain, elicit F-actin-crosslinking ability of fimbacin, although the N-terminal itself does not interact with F-actin (Figures 4, 5 and S5). Since CC domain is known to oligomelized 9, 10, we investigated if fimbacin CC domain also oligomerizes.

9


Biochemistry

Size-exclusion chromatography of purified fimbacin fragments demonstrated that the CC domain mediates oligomerization (octamer) and fimbacin 1-500 is an octamer (Figure S6). Supporting our conclusion, fimbacin 400-500 tagged to GST, which is known to dimerize11, is sufficient to induce bundling with purified actin in vitro (Figure 5). Furthermore fimbacin 400-500 tagged to monomeric His-EGFP was able to pulldown actin filaments but did not induce bundling (Figure S7).

B F-actin+fimbacin (1-360)

A

M a 1- rker 36 1- 0 50 0

His-Halofimbacin

F-actin+fimbacin (1-500)

MW 250 150

200μm

200μm

10μm

10μm

100 75 50 37

C

D

F-actin

F-actin+fimbacin (1-400)

MW

ar k 1- er 40 40 0 050 500 010 2

6

GST-His-fimbacin

M

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 17

200μm

180 135

200μm

100 75

F-actin+fimbacin (400-500) F-actin+fimbacin (500-1026)

65 45 35

200μm

200μm

Figure 5. Fimbacin induces bundling of F-actin. (A) CBB stained gel of His-Halo-fimbacin constructs (B) Confocal microscopy of actin (20 μM) polymerized with purified His-Halo-Fimbacin (1-360aa or 1-500 aa

10


Page 11 of 17 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

residues, 1μM). F-actin is visualized with Alexa 568 phalloidin. The lower panels show high magnification images. (C) CBB stained gel of GSTHis-fimbacin constructs. (D) Fluorescence microscopic images of actin polymerized with GST-His-fimbacin constructs. F-actin is visualized with Alexa 568 phalloidin. Disruption of FLNA-fimbacin interaction and Rho-kinase inhibition alter dynamics of fimbacin in living cells To investigate if fimbacin interacts with FLNA in living cells, we expressed WT and non-FLNA-binding fimbacin-eGFP in MEF cells and performed FRAP analysis (Figure 6). Deletion of FLNA-binding site significantly increased mobile fraction and reduced the τ1/2, strongly suggesting that fimbacin interacts with FLNA in live cells to be stabilized on actin cytoskeleton. Pharmacologic Rho-kinase inhibition with Y27632, which inactivates myosin contraction and opening of R21 of FLNA 12, also increased mobile fraction, but did not significantly affect τ1/2.

11


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 6. FRAP Analysis of fimbacin-eGFP expressed in MEF cells. (A) MEF cells expressing WT or mutant fimbacin-eGFP were imaged before and during recovery after bleaching. Images were taken at the indicated times after the bleach pulse. (B) Quantitative analyses of FRAP results. Curves depict mean values (± SD) from measurements of at least 6 representative cells including those shown (n ≥ 10). WT (black), non-FLN-binding (red), and WT treated with 20μM Y27632 for 30min (blue). (C) Summary of FRAP analysis. (95% confidence intervals) DISCUSSION We have identified a LUZP1 gene product as not only a new FLNAbinding partner but aa novel actin-cross-linking protein as well, adding a new member to the catalogue of actin-binding proteins 13, 14. Since there are many genes of leucine zipper proteins in human genome and LUZP1 protein has never biochemically been characterized, we named it as fimbacin (Filamin mechanobinding and actin cross-linking protein). Fimbacin has two FLNA-binding sites that specifically bind to the CD cleft of R21. The mapped binding sites have a typical FLNA-binding motif, which suggested critical point mutations that disrupt the interaction. As predicted, mutagenesis of these amino acids abolished the interaction, strongly suggesting that fimbacin interacts with FLNA R21 in the same fashion as other FLNA R21-binding partners. Therefore, our results imply that the FLNA-fimbacin interaction could occur under mechanical stress as discussed in the accompanying paper. However, future work is necessary to reveal quaternary structure of the complex: 1) how two FLNA-binding sites of fimbacin interacts with two R21 of FLNA dimer under mechanical stress, and 2) how the FLNA-fimbacin complex cross-links actin filaments. It is also necessary to determine if the predicted CC domain is a genuine coilded-coil. Although the N-terminal domain of fimbacin (1-360aa) is oligomerized to octamer, it is not clear if full-length fimbacin also forms an octamer when it interacts with FLNA. Nevertheless, it is assumed that the oligomerized domain increases valency of fimbacin to enhance its avidity to F-actin and FLNA 8. We demonstrated that fimbacin can interact with natural variant of FLNAvar-1 which constitutively exposes the CD face of R21 due to a lack of 41 amino acids covering the CD face. This suggests that fimbacin can also interact with FLNBvar-1 as FLNB R21 is structurally similar to FLNA R21 and FLNB also has variant-1 (41aa deletion) which is widely expressed in various cells 15. However, future work is necessary to investigate if such variants are co-expressed with fimbacin during animal development. As other proteins also interact with R21, it would be interesting to determine how they compete with fimbacin and smoothelin (the accompanying paper). However, fimbacin and smoothelin have higher H/L ratio (Log2(H/L) ≅ 3.9 and 2.9 respectively) on Maxquant and Perseus analysis compared to integrin beta-1 Log2(H/L) ≅ 0.35) (Table S1 in the accompanying paper), suggesting that fimbacin and smoothelin have much higher affinity and/or are more abundant than integrin beta-1. We have mapped an actin-binding domain between residues 400 and 500, which does not have homology to known actin-binding proteins by BLAST search. Further characterization of this new domain would help to identify unknown actin-binding proteins. Since deletion of the C-

12


Page 12 of 17

Page 13 of 17 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

terminal of fimbacin also diminished strong colocalization of fimbacin on actin stress fiber (eg. Some cytosolic localization was detected with fimbacin 1-500, 1-600, and 1-700.), the C-terminal also plays a role in the interaction of fimbacin with actin cytoskeleton. FRAP analysis supports the biochemical characterization of fimbacin, showing that even without FLNA-binding, some fimbacin stays in immobile fraction most likely due to direct interaction to F-actin. FRAP analysis also clearly demonstrated that interaction of fimbacin with FLNA stabilizes fimbacin on the actin cytoskeleton. Pharmacologic Rho-kinase inhibition with Y27632, which inactivates myosin contraction and opening of R21 of FLNA 12, also increased mobile fraction, but did not significantly affect τ1/2. These results suggest that force-dependent interaction of fimbacin with FLNA occurs in living cells and tightly anchors fimbacin at FLNA-mediated junctions of F-actin. However, τ1/2 is significantly unaffected, which means that the rate at which unbleached fluorescent molecules move into the FRAP zone is not affected, implying that Rho-kinase inhibition does not affect diffusion of fimbacin. These results suggest that mechanical force exposes FLNA R21 to immobilize fimbacin tightly on the actin cytoskeleton through FLNA. However, the physiological role of their force-dependent interaction needs further investigation. In conclusion, our identification and characterization of two novel FLNA-mechanobinding partners, SMTN and fimbacin, set the stage for generating a knock-in animal to investigate the function of their interaction with FLNA in situ.

13


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Funding

This work is supported by the National Natural Science Foundation of China (31771551 to F.N.). Notes The authors declare that they have no conflicts of interest with the contents of this article. Contributions F.N. designed the experiments. J.W. and F.N. carried out the experiments and analyzed the data. F.N. wrote the paper. SUPPORTING INFORMATION Figure S1 (Expression of fimbacin in human and mouse cell lines), Figure S2 (Identification of FLNA-binding sites on fimbacin), Figure S3 (Comparison of the amino acid sequence of fimbacin from different species), Figure S4 (Localization of fimbacin fused to three different tags (Myc and eGFP at the Cterminal, AcGFP at the N-terminal) in cells), Figure S5 (Deletion of FLNA binding site does not abolish colocalization of fimbacin with F-actin), Figure S6 (Mapping of F-actin binding domain of fimbacin), and Figure S7 (Fimbacin is oligomerized through the N-terminal domain). REFERENCES

[1] Sun, D. S., Chang, A. C., Jenkins, N. A., Gilbert, D. J., Copeland, N. G., and Chang, N. C. (1996) Identification, molecular characterization, and chromosomal localization of the cDNA encoding a novel leucine zipper motif-containing protein, Genomics 36, 54-62. [2] Zaveri, H. P., Beck, T. F., Hernandez-Garcia, A., Shelly, K. E., Montgomery, T., van Haeringen, A., Anderlid, B. M., Patel, C., Goel, H., Houge, G., Morrow, B. E., Cheung, S. W., Lalani, S. R., and Scott, D. A. (2014) Identification of critical regions and candidate genes for cardiovascular malformations and cardiomyopathy associated with deletions of chromosome 1p36, PLoS ONE 9, e85600. [3] Hsu, C. Y., Chang, N. C., Lee, M. W., Lee, K. H., Sun, D. S., Lai, C., and Chang, A. C. (2008) LUZP deficiency affects neural tube closure during brain development, Biochemical and biophysical research communications 376, 466-471. [4] Lee, M. W., Chang, A. C., Sun, D. S., Hsu, C. Y., and Chang, N. C. (2001) Restricted expression of LUZP in neural lineage cells: a study in embryonic stem cells, Journal of biomedical science 8, 504-511.

14


Page 14 of 17

Page 15 of 17 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Biochemistry

[5] Ehrlicher, A. J., Nakamura, F., Hartwig, J. H., Weitz, D. A., and Stossel, T. P. (2011) Mechanical strain in actin networks regulates FilGAP and integrin binding to filamin A, Nature 478, 260-263. [6] Rognoni, L., Stigler, J., Pelz, B., Ylanne, J., and Rief, M. (2012) Dynamic force sensing of filamin revealed in singlemolecule experiments, Proc Natl Acad Sci U S A 109, 1967919684. [7] Chen, H., Chandrasekar, S., Sheetz, M. P., Stossel, T. P., Nakamura, F., and Yan, J. (2013) Mechanical perturbation of filamin A immunoglobulin repeats 20-21 reveals potential non-equilibrium mechanochemical partner binding function, Scientific reports 3, 1642. [8] Nakamura, F., Osborn, T. M., Hartemink, C. A., Hartwig, J. H., and Stossel, T. P. (2007) Structural basis of filamin A functions, J Cell Biol 179, 1011-1025. [9] Nakamura, F., Heikkinen, O., Pentikainen, O. T., Osborn, T. M., Kasza, K. E., Weitz, D. A., Kupiainen, O., Permi, P., Kilpelainen, I., Ylanne, J., Hartwig, J. H., and Stossel, T. P. (2009) Molecular basis of filamin A-FilGAP interaction and its impairment in congenital disorders associated with filamin A mutations, PLoS ONE 4, e4928. [10] Burkhard, P., Stetefeld, J., and Strelkov, S. V. (2001) Coiled coils: a highly versatile protein folding motif, Trends in cell biology 11, 82-88. [11] Lim, K., Ho, J. X., Keeling, K., Gilliland, G. L., Ji, X., Ruker, F., and Carter, D. C. (1994) Three-dimensional structure of Schistosoma japonicum glutathione Stransferase fused with a six-amino acid conserved neutralizing epitope of gp41 from HIV, Protein Sci 3, 22332244. [12] Nakamura, F., Song, M., Hartwig, J. H., and Stossel, T. P. (2014) Documentation and localization of force-mediated filamin A domain perturbations in moving cells, Nature communications 5, 4656. [13] Uribe, R., and Jay, D. (2009) A review of actin binding proteins: new perspectives, Mol Biol Rep 36, 121-125. [14] Pollard, T. D. (2016) Actin and Actin-Binding Proteins, Cold Spring Harb Perspect Biol 8. [15] van der Flier, A., Kuikman, I., Kramer, D., Geerts, D., Kreft, M., Takafuta, T., Shapiro, S. S., and Sonnenberg, A. (2002) Different splice variants of filamin-B affect myogenesis, subcellular distribution, and determine binding to integrin [beta] subunits, J Cell Biol 156, 361-376.

15


Biochemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACCESSION CODES LUZP1 Q86V48 FLNA P21333

16


Page 16 of 17

Page 17 of 17 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39

Biochemistry

Fimbacin: filamin mechanobinding actin crosslinking protein

F-actin Fimbacin

Filamin A Mechanical force


Identification of a filamin A mechanobinding partner II: Fimbacin is a

Recommend Documents