Chem. Res. Toxicol. 1997, 10, 85-90
85
Interaction of Aflatoxin B1 with Cytochrome P450 2A5 and Its Mutants: Correlation with Metabolic Activation and Toxicity Pa¨ivi Pelkonen,†,‡ Matti A. Lang,‡ Masahiko Negishi,§ Christopher P. Wild,| and Risto O. Juvonen*,† Department of Pharmacology and Toxicology, University of Kuopio, POB 1627, 70211 Kuopio, Finland, International Agency for Research on Cancer, 150 Cours Albert-Thomas, 69372 Lyon Cedex 08, France, Laboratory of Reproductive and Developmental Toxicology, National Institutes of Environmental Health Sciences, POB 12233, Research Triangle Park, North Carolina 27709, and Molecular Epidemiology Unit, Research School of Medicine, 24 Hyde Terrace, University of Leeds, Leeds LS16 6BG, U.K. Received May 6, 1996X
Among members of the mouse cytochrome P450 2A family, P450 2A5 is the best catalyst of aflatoxin B1 (AFB1) oxidation to its 8,9-epoxide (Pelkonen, P., Lang, M., Wild, C. P., Negishi, M., and Juvonen, R. O. (1994) Eur. J. Pharmacol., Environ. Toxicol. Pharmacol. Sect. 292, 67-73). Here we studied the role of amino acid residues 209 and 365 of the P450 2A5 in the metabolism and toxicity of AFB1 using recombinant yeasts. The two sites have previously been shown to be essential in the interaction of coumarin and steroids with the P450 2A5. Reducing the size of the amino acid at position 209 or introducing a negatively charged residue at this site increased the 8,9-epoxidation of AFB1 compared to the wild type. In addition, replacing the hydrophobic amino acid at the 365 position with a positively charged lysine residue strongly decreased the metabolism of AFB1. These mutations changed the KM values generally less than the Vmax values. The changes in AFB1 metabolism contrast with the changes in coumarin 7-hydroxylation caused by these amino acid substitutions, since reducing the size of the 209 residue strongly reduced coumarin metabolism and increased the KM values. On the other hand, the results with AFB1 are similar to those obtained with steroid hydroxylation. This suggests that the size of the substrate is important when interacting with the residue 209 of the protein. The catalytic parameters of AFB1 correlated generally with its toxicity to the recombinant yeasts expressing the activating enzyme and with the binding of AFB1 to yeast DNA. Furthermore high affinity substrates and inhibitors (e.g., methoxsalen, metyrapone, coumarin 311, 7-methylcoumarin, coumarin, and pilocarpine) of P450 2A5 could efficiently block the toxicity of AFB1. It is suggested that the recombinant yeasts expressing engineered P450 enzymes are a useful model to understand the substrate protein interactions, to study the relationship of metabolic parameters to toxicity, and to test potential inhibitors of metabolism based toxicity.
Introduction )1
To exert its toxic effects, aflatoxin B1 (AFB1 needs to be metabolized to 8,9-epoxide (1-3) by several P450 enzymes including 1A2, 2A, and 3A (4-10). P450 2A enzymes contribute to metabolic activation of AFB1 in several species including human (4-7). Antibodies against rat P450 2A inhibited the formation of AFB1 8,9-epoxide by 13-47% in various human liver microsomes (5), and antibody against mouse P450 2A5 inhibits aflatoxin B1 epoxidation by up to 50% in hamster liver microsomes (7). Furthermore, human P450 2A6 expressed in transformed cells activates AFB1 to a mutagen in the Salmonella typhimurium test system as do mouse P450 2A4 and 2A5 in transformed yeast cells (6, 11). * Correspondence to Risto O. Juvonen, Department of Pharmacology and Toxicology, University of Kuopio, POB 1627, 70211 Kuopio, Finland, tel. +358-17-162010, fax +358-17-162424, mail
[email protected]. † University of Kuopio. ‡ International Agency for Research on Cancer. § National Institutes of Environmental Health Sciences. | University of Leeds. X Abstract published in Advance ACS Abstracts, December 15, 1996. 1 Abbreviations: AFB , aflatoxin B ; AFM , aflatoxin M ; AFP , 1 1 1 1 1 aflatoxin P1; AFQ1, aflatoxin Q1; P450(s), cytochrome P450; ELISA, enzyme-linked immunosorbent assay.
S0893-228x(96)00078-1 CCC: $14.00
In mouse liver, three highly homologous P450 2A enzymes are expressed (namely, P450 2A4, P450 2A5, and P450 7R) having high specific activities for testosterone 15R-hydroxylation, coumarin 7-hydroxylation, and testosterone 7R-hydroxylation, respectively (12-15). Recently we showed that AFB1 8,9-epoxide is formed by P450 2A4 and P450 2A5 but practically not at all by P450 7R (11). In spite of their extremely high sequence identity (only 11 amino acid residues out of a total 494 are different) the KM value of P450 2A5 for AFB1 is about 50 times lower than the value of P450 2A4. This could indicate that P450 2A5 is more important in vivo in the bioactivation of AFB1 than P450 2A4 and that only minor changes in the protein conformation may dramatically affect the interaction with the substrates. For the activities of steroid 15R-hydroxylase and coumarin 7-hydroxylase of P450 2A4 and P450 2A5, respectively, amino acid residues 117, 209, and 365 are essential (16). For example, mutating Phe209 of P450 2A5 to Leu confers steroid 15R-hydroxylase to coumarin 7-hydroxylase activity. In addition, the affinity of the enzymes for coumarin is dependent on the size of residue 209, and the nature of this residue determines the rate of coumarin 7-hydroxylation (17). Since the interaction © 1997 American Chemical Society
86
Chem. Res. Toxicol., Vol. 10, No. 1, 1997
Pelkonen et al.
of AFB1 with P450 2A4 and P450 2A5 seems to be different with testosterone and coumarin, we tested whether amino acid changes at these critical sites also affect the 8,9-epoxidation of AFB1. The substrate protein interactions and the toxic effects of the metabolic activation were studied in yeast cells transformed by the enzymes and their mutants. Further, several known substrates or inhibitors of P450 2A5 were tested for their ability to inhibit bioactivation of AFB1.
Experimental Procedures Caution: Aflatoxin B1 is carcinogenic, and pilocarpine and bispilocarpine are potent cholinomimetic drugs; they all should be handled with care. Chemicals. Coumarin, coumarin 311, 7-methylcoumarin, dilauroylphosphatidylcholine, sorbitol, testosterone, metyrapone, and aflatoxin B1 were obtained from Sigma Chemical Co. (St. Louis, MO); NADP, NADPH, glucose 6-phosphate, and glucose 6-phosphate dehydrogenase were from Boehringer Mannheim (Germany); Zymolyase 20-T from ICN Biomedicals (Costa Mesa, CA); yeast nitrogen base without amino acid and bacto-agarose were from Difco (Detroit, MI); glucose was from BDH Laboratory Supplies (Poole, England); pilocarpine was from Leiras (Turku, Finland); bispilocarpine was kindly provided by Dr. Tomi Ja¨rvinen, University of Kuopio, Finland, and methoxsalen by Dr. Jukka Ma¨enpa¨a¨, University of Oulu, Finland. Biological Material. The construction of pAAH5 expression vector system in Saccharomyces cerevisiae AH22 cells for mouse liver P450 2A5 and its mutants of residue 209 is described in earlier publications (17-19). Residues of amino acid 365 were mutated using pSELECTtm-1 vector (Promega, Madison, WI) and primers 5′-AGATTTGCAGACAAGATCCCCATGGGC, 5′AGATTTGCAGACATTATCCCCATGGGC, and 5′-AGATTTGCAGACTTCATCCCCATGGGC for Met365Lys, Met365Ile, and Met365Phe. The mutated cDNAs were ligated to pAAH5 vector and transfected to S. cerevisiae AH22. The expression level was the same for all enzymes. Purification of the enzymes is described in earlier papers (17, 19). Metabolism of AFB1. The conditions for epoxidation in the reconstituted system were described previously (11) and comprised reaction mixtures containing 2-15 pmol of P450, 4-30 pmol of NADPH-cytochrome P450 reductase, 0.8-6 nmol of dilauroylphosphatidylcholine, 77 mM Tris-HCl buffer (pH 7.4), 5 mM MgCl2, 0.4 mM NADP, 5.75 mM glucose 6-phosphate, 0.075 U of glucose 6-phosphate dehydrogenase, and 0.5-100 µM AFB1. AFB1 8,9-epoxide measured indirectly as a tris-diol adduct, aflatoxin M1, aflatoxin Q1, and aflatoxin P1 were analyzed by high performance liquid chromatography, as previously described by Kirby and co-workers (20). It should be noted that mouse liver microsomes have been shown to produce almost exclusively the exo-8,9-epoxide,2 and therefore it is most likely that the epoxide formed in these studies is of this form. Toxicity of AFB1 for the Recombinant Yeasts. Details of the test have been described by Pelkonen and co-workers (11). Briefly, recombinant yeast cells were incubated in growth medium in the presence of AFB1 for 4 h at 30 °C and then transferred onto the Petri dish, and after 3 days’ incubation, the number of colonies was calculated. In the rescue tests, the inhibitors of P450 2A5 were added together with the AFB1. The pH of the yeast medium was 5.5, and in the experiments indicated phosphate buffer was used to increase it to 7.0. Measurement of AFB1-DNA Adducts. DNA was prepared from about 1 × 109 yeast cells in culture by the method described by Ausubel and co-workers (11, 21). AFB1-DNA adducts were measured by ELISA as described (22) in duplicate cultures. The statistical analysis of kinetics of epoxidation of AFB1 was made by GraphPad PRISM version 2.0. 2
D. L. Eaton, Personal communication.
Figure 1. HPLC chromatogram of the analysis of AFB1 metabolism. 50 µM AFB1 was incubated in the reconstituted system with mutant Phe209Asp, and the reaction was stopped by addition of ice cold ethanol after 10 min. Formation of AFB1 8,9-epoxide, as measured by determination of the AFB1-tris-diol complex , and AFM1 was as described in detail in the Experimental Procedures. In the chromatogram the tris-diol is represented by peaks at 14.3 and 15.09 min as demonstrated by the absence of these peaks in reactions in which the tris was omitted. Other peaks are as follows: 18.69, AFM1; 24.15, unmetabolized AFB1; 26.77, aflatoxicol internal standard. Both fluoresence (400 nm) and UV (365 nm) were monitored to allow optimum quantification of tris-diol and the other metabolites, respectively. In this example, the y axis is fluoresence.
Results Role of Residues 209 and 365 of P450 2A5 in the Epoxidation of AFB1. These amino acid residues are critical for the binding and metabolism of coumarin, a specific substrate of P450 2A5 (16, 17). We therefore wanted to know if they also affect AFB1 epoxidation. Two peaks for AFB1-tris-diol were observed (Figure 1). These peaks were always in the same ratio for all mutants and at all AFB1 concentrations; although their identities were not further characterized, both peaks were eliminated by omitting tris from the reaction mixture (data not shown). Mouse liver microsomes were only previously found to produce exo-8,9-epoxide,2 and this observation would not be consistent with these two peaks representing the exoand endo-epoxides of AFB1. Replacing the Phe209 residue of the wild type with six different amino acids increased the epoxidation rate (Table 1 and Figure 2.). The highest rate was reached with Phe209Gly, Phe209Val, and Phe209Asn with a 5-fold higher Vmax value than obtained for the wild type, followed by Phe209Asp, Phe209Leu, and Phe209Ala. The KM value of AFB1 to the enzyme was also dependent to some extent on the residue at position 209 (Table 1). In Phe209Asn it was decreased to half of the value of wild type, and in Phe209Val and Phe209Leu it increased 1.8- and 3.5-fold. These data demonstrate that residue 209 influences reaction kinetic parameters of AFB1 epoxidation by P450 2A5. It is noteworthy that an engineered protein such
Interaction of Aflatoxin B1 with P450 2A5
Chem. Res. Toxicol., Vol. 10, No. 1, 1997 87
Table 1. Effect of Residue 209 in P450 2A5 on 8,9-Epoxide Formation and Toxicity of AFB1a Part A type of P4502A5 Phe209 (wild) Phe209Leu Phe209Val Phe209Ala Phe209Gly Phe209Asn Phe209Asp yeast without recombinant p450
8,9-epoxide formation with 50 µM AFB1 15 ( 3 (15) 30 ( 4 (4) 63 ( 6 (5) 22 ( 8 (6) 82 ( 9 (3) 91 ( 11 (7) 47 ( 18 (4) ND
Part B KM (AFB1) (µM)
Vmax [nmol/ (nmol of P450‚min)]
LC50 of yeast cells (µM)
AFB1-DNA adduct (pmol/mg of DNA)
11 (4-18) 39 (12-64) 18 (11-25) 11 (5-16) 6 (3-9) ND
16 (13-20) 56 (35-77) 84 (70-99) 77 (63-90) 81 (69-93) ND
0.4 ( 0.2 (3) 0.8 ( 0.3 (3) 0.29 ( 0.05 (3) 0.04 ( 0.01 (3) 0.04 ( 0.01 (3) 0.04 ( 0.02 (3) 0.07 ( 0.01 (3) not sensitive
77 ( 14 (5) 18 ( 5 (5) 50 ( 14 (4) 1100 ( 400 (6) 2400 ( 1400 (6) 1600 ( 300 (6) 1100 ( 100
