Label-Free DNA Assay by Metal Stable Isotope Detection - Analytical

Subscriber access provided by University of Florida | Smathers Libraries

Article

Label-free DNA Assay by Metal Stable Isotope Detection Rui Liu, Chaoqun Wang, Yuming Xu, Jianyu Hu, Dongyan Deng, and Yi Lv Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.analchem.7b03327 • Publication Date (Web): 22 Nov 2017 Downloaded from http://pubs.acs.org on November 23, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Analytical Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 22 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

Label-free DNA Assay by Metal Stable Isotope Detection Rui Liu,† Chaoqun Wang,† Yuming Xu,‡ Jianyu Hu,† Dongyan Deng,† Yi Lv† *

†

Key Laboratory of Green Chemistry & Technology, Ministry of Education, College of Chemistry,

Sichuan University, Chengdu, Sichuan 610064, P.R. China ‡

College of Materials and Chemistry & Chemical Engineering, Chengdu University of Technology,

Chengdu, Sichuan 610059, P.R. China

*Corresponding Author. Email: [email protected]; Tel. & Fax +86-28-8541-2798

1

ACS Paragon Plus Environment

Analytical Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT: The interest in label-free bioassays is increasing rapidly because of their simple procedure and direct information of the interaction between the target molecule and the sensing unit. One of the major obstacles in the application of label-free biosensors is the difficulty to produce stable and reproducible optical, electric, electrochemical, or magnetic properties for the sensitive detection of the target molecules. In this work, we demonstrated a label-free DNA assay, by directly measuring the intrinsic

63

Cu and

65

Cu stable isotopes inside the double strand DNA-templated Cu

nanoparticles. The experimental conditions, including detection of copper by elemental mass spectrometry, the copper nanoparticles formation parameters, the hybrid chain reaction parameters, and analytical performance, were investigated in detail. The 63Cu signal intensity possesses a linear relation with the concentration of target DNA over the range of 20-1000 pM with a detection limit of 4 pM (3σ). The detection limit of this method is among the most sensitive label-free techniques, and also comparable to the lanthanides and Au nanoparticles labeled assays by elemental mass spectrometric detection. The proposed label-free bioassay is simple and sensitive, and eliminated the need of optical, electric, electrochemical, magnetic properties of sensing unit. To our best knowledge, this is the first report of the label-free bioassay by metal stable isotope detection.

2


Page 2 of 22

Page 3 of 22 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


INTRODUCTION Nowadays, the interest in label-free bioassays is increasing rapidly because of their simple procedure and direct information of the interaction between the target molecule and sensing unit1-2. For instance, in general label-free DNA assays, sensing unit is attached non-covalently on DNA through interaction forces such as electrostatic interaction, intercalation, and groove binding etc. They show enhanced luminescence after interaction with target DNA molecules because their excited states are protected by the oligonucleotide’s hydrophobic interior.3 Therefore, the target biomolecule caused structure-transformation of the oligonucleotide can produce an optical signal. Thanks to the fast development of DNA based detection platform (e.g., electrochemical platform4 and fluorescent platform5-7), the label-free DNA assay also provide great opportunity for applications in label-free immunologic, enzymatic, and other bioassays1,3. However, one of the major obstacles in the application of label-free biosensors is the difficulty to produce stable and reproducible optical, electric, electrochemical, magnetic properties for the sensitive detection of the target molecules. Via detecting metal stable isotopes, elemental mass spectrometry-based bioassay has demonstrated great potential and been proved successful for proteins8-12, nucleic acids13-18, and single cells19-23 analysis. The advantages of elemental mass spectrometry-based bioassay include24-29 (i) No need of special feature such as radioactive, optical, electric, electrochemical, magnetic property; (ii) Low limits of detection of pg mL-1 level for metal isotopes; (iii) Wide dynamic ranges of 9 orders of magnitude; (iv) The excellent mass spectral resolution and low matrix effect for multiplex bioassay; (v) The high metrological value for absolute quantification. During the assay, nanoparticles (NPs) tags are usually employed for the high sensitivity, thanks to the great amount of detectable stable isotopes in each nanoparticle tag. However, the cumbersome labeling procedure and vulnerable 3



Page 4 of 22

nanoparticle-biomolecule conjugate often require sophisticated design and optimization. Herein, we describe the design and application of a label-free elemental mass spectrometry-based bioassay, eliminating the need of special sensing properties (optical, electric, electrochemical etc.). The copper nanoparticles, used as the metal isotope sensing unit, can be templated formed on double-strand DNA30-34, while much fewer nanoparticles are formed on single-strand DNA35. Thus the hybridization of target DNA and probe DNA could trigger a turn-on mass spectrometric response from templated formed Cu nanoparticles. The intrinsic

63

Cu and

65

Cu isotopes inside the Cu

nanoparticle are directly and sensitively detected. The formation conditions of double-strand DNA templated copper nanoparticles are mild without any rigorous agitation, heating/cooling and irradiation treatment, which result in a good repeatability. By employing the hybridization chain reaction (HCR) for signal amplification, the proposed mass spectrometric bioassay system shows a highly sensitive response to the target DNA.

EXPERIMENTAL SECTION Instruments An inductively coupled plasma mass spectrometer (ICPMS, ELAN DRC™-e, PerkinElmer, Inc.) was employed throughout the study. The ICPMS parameters was optimized according to the manual of the instrument manufacturer. The dead time of ICPMS instrument (50 ns) was acquired by testing the

204

Pb/206Pb ratios in a series of standard solutions. The experimental conditions of ICPMS are

summarized in Table 1. Single-channel and eight-channel pipettors (Dragon Laboratory Instruments, China) were used for the solution transfer. The morphology of the formed Cu NPs was recorded by a JEM-2010 transmission electron microscopy (TEM). 4


Page 5 of 22 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Reagents Deionized water (DIW, 18.2 MΩ cm-1) was used throughout this study. Polystyrene 96-well amino microplates were employed for the DNA assay. All glassware was firstly washed by aquaregia solution, flushed with DIW, and dried by a vacuum oven. Table 2 listed the sequences of all oligonucleotides. The oligonucleotides were synthesized by Shanghai Sangon Inc (Shanghai, China). 3-(N-morpholino)-propane sulfonic acid (MOPS), sodium ascorbate and copper sulfate were obtained from Changzheng Chemical Reagent Inc.(Chengdu, China). MOPS buffer solution (20 mM MOPS, 300 mM NaCl, pH = 7.5) and PBS buffer (10 mM PB, 20 mM NaCl, pH = 7.4) were used in this study. All the chemical reagents were of analytical reagent grade.

Assay Procedure The hairpin DNAs H1/H2were heated to 90 oC for 5 min and cooled at room temperature for 60 min. Capture DNAs were localized on microtiterplates at 5’-end amino via covalent binding. The localization of capture DNAs on microtiter plate and hybridization of capture DNAs with target DNAs were performed referring to literatures36-37. After the localization of capture DNAs (200 µL, 0.25 µM) at 37 oC overnight, the wells were blocked by blocking buffer (5% BSA in PBS buffer) at 37 oC for 5 h and washed three times by PBS buffer (with 0.05% Tween 20) and twice by MOPS buffer. The DNA hybridization reaction was carried out in MOPS buffer. In the hybridization process, target DNAs (200 µL) were added in each well at 37 oC. After 2 h, the microplates were washed by MOPS buffer for three times. Afterwards, HCR was carried out by adding hairpin DNAs in the microtiter plates to a final concentration of 1 µM. After 60 min HCR and three times washing by MOPS buffer, 3 mM ascorbic acid and 300 µM copper sulfate were added into the microtiter plate, respectively. After 10 min incubation, the solutions in the microplates were poured out. The copper 5



NPs formed at the bottom of microtiter plates were rinsed thrice by DIW. After reacted with 200 µL nitric acid (20% v/v) for 30 min, the resulted copper solution was diluted to 4mL.The target DNA concentration was calculated base on 63Cu isotope signal of ICPMS.

RESULTS AND DISCUSSION Templated Formation of CuNPs on Double Strand DNA In this work, a label-free and sensitive DNA detection method was established by using HCR amplification and stable isotope signal of dsDNA-templated Cu NPs. As illustrated in Fig. 1, each hairpin DNA has an 18 bp stem with a loop of 6 nucleotides. They also have another sticky end of 6 nucleotides. The target DNA reacted with the capture DNA on the microtiter plates, and formed a hybridized dsDNA with a 15 nucleotide sticky end. The sticky end induced the HCR procedure and the formation of dsDNA polymers while two hairpin DNAs are existed. And then the excessive hairpin DNAsH1/H2 were poured out from microtiter plates. After washing with MOPS buffer, Cu NPs were formed on the dsDNA polymers inside the microtiter plates. In the presence of hairpin DNA H1/H2and absence of the target DNA, there were no dsDNA formed on the bottom of microtiter plates, and thus no obvious mass spectrometric signal was observed (A of Fig. 2a). In the presence of target DNA without hairpin DNAs, low mass spectrometric signal was obtained (B of Fig. 2a). Hybridization products of capture DNA and target DNA is only 15 bp, thus few Cu NPs were formed. While with both hairpin DNAs and target DNAs, target DNAs hybridized together with the capture probe localized on the bottom of microtitor plates to form partial dsDNA with a sticky end of 15 nucleotide, which acted as the initiator for HCR. As shown in the figure (C of Fig. 2a), 1

6


Page 6 of 22

Page 7 of 22 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


nM target DNA was expected to induce the DNA hybridization and generated long dsDNA polymers, result in a significant increase of the mass spectrometric signal intensity of Cu. Without the immobilization of capture DNA on microtiter plates, the production of Cu NPs on the dsDNA polymer formed by HCR was observed by TEM. As shown in Fig. 2b, several Cu NPs could be clearly observed, and the diameter was about 5-10 nm. Moreover, the formed Cu NPs were characterized by ultraviolet-visible absorption spectrophotometry and fluorescence spectroscopy. The results are shown in Fig. 2c and Fig. 2d. The maximum emission and absorption wavelengths of the Cu NPs are 614 nm and 265 nm, respectively, which are in good accordance with the literature values30.Theseresults confirmed that dsDNA formed by HCR can work efficiently as template for CuNPs formation. Since Cu nanoparticles formed via hybridization between hairpins DNAs for multiple HCR cycles can be detected by elemental mass spectrometry, a label-free and sensitive bioassay is established.

ICPMS Detection of Copper Cu has two isotopes with abundances of 69.17% (63Cu) and 30.83% (65Cu), respectively. Polyatomic interferences38 are reported in complicated sample matrix (Table S1).They have the same mass number as

63

Cu and

65

Cu, respectively. During the current bioassay, the sample matrix was very

simple by using reagents of high purity and deionized water of 18.2 MΩ cm-1. Consequently, the polyatomic interferences was found to be negligible. Both 63

proposed bioassay. As shown in Fig. 3a, around two-fold higher sensitivity over

63

Cu and

65

Cu are suitable for the

Cu was chosen as analyte in further studies, due to the

65

Cu. Cu standard solution of 10 ng mL-1 was used for the

optimization of 63Cu signal. The influence of radiofrequency power on 63Cu signal was studied. The maximum intensity for

63

Cu was acquired under the radio frequency power of 1300 W. Under the 7



Page 8 of 22

higher radio frequency power, doubly charged ions may produce and thus decrease the analyte signal. 63

Cu signal intensity can be also greatly affected by nebulizer gas flow rate. The relationship between

the nebulizer gas flow rate and

63

Cu signal intensity was investigated. The maximum intensity for

63

Cu was obtained at 1.0 L min-1 nebulizer argon gas flow rate. After the optimization of

experimental parameters, the calibration curves of

63

Cu was established with standard copper

solutions (Fig. 3b). The linear equation of Y = 8484 X + 264 for

63

Cu isotope was obtained, with

detection limit (3σ) of 0.0042 ng mL-1.

Optimization of Experimental Conditions The experimental parameters, including the concentration of copper sulfate, the concentration of sodium ascorbate, the hairpin DNAs concentration, and the HCR reaction time, were studied in detail to obtain high performance bioassay. Cu(I) was produced from the reduction of copper sulfate by sodium ascorbate, which was disproportionate rapidly to Cu(II) and Cu. The Cu was concentrated on the major groove of dsDNA, thus the CuNPs were formed30. When the molar concentration of dsDNA is fixed, the formation of Cu NPs would be strongly influenced by the concentration of copper sulfate and sodium ascorbate. The effect of the concentration of copper sulfate and the concentration of sodium ascorbate are shown in Fig. 4a and Fig. 4b, respectively. Maximum signal to noise ratio was achieved with 300 µM copper sulfate and 3 mM sodium ascorbate, respectively, which were employed in the subsequent experiments. The effect of H1/H2 concentration from 100 nM to 2 µM was also examined. The best analytical performance was achieved when the concentration of hairpin probes was 1 µM, which was selected for further studies. The effect of HCR reaction time was also investigated. With increasing reaction time of HCR process, signal to noise

8


Page 9 of 22 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


ratio increased and then almost kept constant when the reaction time of amplification was higher than 60 min, which was selected for further studies.

Analytical Performance Under optimal conditions, the relationship of the 63Cu signal and the target DNA concentration was studied. As shown in the inset of Fig.5a, the dynamic range of the DNA concentration from 20 pM to 1000 pM was obtained using ICPMS

63

Cu intensity. The linear equation was found to be Y =

1.22E2X + 1.4E4, with the correlation coefficient R= 0.9940. And the detection limit was 4 pM (3σ). The reproducibility expressed as relative standard deviation (RSD) was 4.2% (n=7) for target DNA of 200 pM. In Table 3, the proposed bioassay is compared with some other widely accepted label-free assays for DNA quantification. The detection limit of the proposed bioassay is among the most sensitive label-free techniques. It is also comparable to the lanthanides and Au NPs labeled assays reported by ICPMS detection. The specific recognition of target DNA by the proposed ICPMS label-free assay was also studied. Fig. 5b showed the results. A relatively low signal intensity was acquired by DNA of completely mismatched based pair (10 nM). The signal of DNA of single base mismatched (10 nM) was also significantly lower than target DNA (1 nM), which validated a favorable specific recognition of the present bioassay. To validate the proposed DNA assay to real biological samples, five human serum samples spiked with different concentrations of target DNA were analyzed. As shown in Table S2, the spiked recoveries were in the range of 90%-107% with a RSD lower than 6.6%. The results demonstrated the tolerance of the proposed method to the complicated sample matrix of serum.

CONCLUSIONS 9



A sensitive label-free DNA assay has been demonstrated by the detection of Cu isotopes inside the Cu NPs. The special properties such as optical, electric, electrochemical, magnetic features are not required for Cu NPs sensing unit by elemental mass spectrometric detection. The experimental procedure is simple, easy to operate, and low cost. Signal amplification schemes, such as ligation-mediated amplification and rolling circle amplification, are potentially adoptable for the development of sensitive label-free ICPMS bioassays. The proposed method possesses great potential for sensitive and label-free immunoassay, enzymatic assay etc.

ACKNOWLEDGMENTS Dr. Shanlin Wang of Sichuan University is thanked for TEM analysis. The National Natural Science Foundation of China is gratefully acknowledged (Nos. 21575093, 21505008,and 21505095).

Supporting Information Available: The Supporting Information is available free of charge on the Internet at http://pubs.acs.org Potential Polyatomic Interferences to

63

Cu and

65

Cu;Detection of Target DNA in spiked human

serum samples

10


Page 10 of 22

Page 11 of 22 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


REFERENCES (1) Luo, X. L.; Davis, J. J. Chem. Soc. Rev. 2013, 42, 5944-5962. (2) Carrascosa, L. G.; Huertas, C. S.; Lechuga, L. M. TrAC-Trends Anal. Chem.2016, 80, 177-189. (3) Ma, D. L.; He, H. Z.; Leung, K. H.; Zhong, H. J.; Chan, D. S. H.; Leung, C. H. Chem. Soc. Rev. 2013, 42, 3427-3440. (4) Li, H.; Arroyo-Curras, N.; Kang, D.; Ricci, F.; Plaxco, K. W. J. Am. Chem. Soc. 2016, 138, 15809-15812. (5) Kahveci, Z.; Martinez-Tome, M. J.; Mallavia, R.; Mateo, C. R. ACS Appl. Mater. Interfaces2017, 9, 136-144. (6) Wang, M. D.; Mao, Z. F.; Kang, T. S.; Wong, C. Y.; Mergny, J. L.; Leung, C. H.; Ma, D. L. Chem. Sci. 2016, 7, 2516-2523. (7) Lin, S.; Lu, L. H.; Kang, T. S.; Mergny, J. L.; Leung, C. H.; Ma, D. L. Anal. Chem. 2016, 88, 10290-10295. (8) Zhang, C.; Zhang, Z. Y.; Yu, B. B.; Shi, J. J.; Zhang, X. R. Anal. Chem. 2002, 74, 96-99. (9) Baranov, V. I.; Quinn, Z.; Bandura, D. R.; Tanner, S. D. Anal. Chem. 2002, 74, 1629-1636. (10) Liu, R.; Liu, X.; Tang, Y. R.; Wu, L.; Hou, X. D.; Lv, Y. Anal. Chem. 2011, 83, 2330-2336 (11) Liu, R.; Lv, Y.; Hou, X. D.; Mester, Z.; Yang, L. Anal. Chem. 2012, 84, 2769-2775. (12) Liu, R.; Hou, X.; Lv, Y.; McCooeye, M.; Yang, L.; Mester, Z. Anal. Chem. 2013, 85, 4087-4093. (13) Brückner, K.; Schwarz, K.; Beck, S.; Linscheid, M. W. Anal. Chem.2013, 86, 585-591. (14) Luo, Y.; Yan, X.; Huang, Y.; Wen, R.; Li, Z.; Yang, L.; Yang, C. J.; Wang, Q. Anal. Chem. 2013, 85, 9428-9432. (15) de Bang, T. C.; Shah, P.; Cho, S. K.; Yang, S. W.; Husted, S. Anal. Chem. 2014, 86, 6823–6826 11



(16) He, Y.; Chen, D.; Li, M.; Fang, L.; Yang, W.; Xu, L.; Fu, F. Biosens. Bioelectron. 2014, 58, 209-213. (17) Zhang, S.; Liu, R.; Xing, Z.; Zhang, S.; Zhang, X. Chem. Commun. 2016, 52, 14310-14313. (18) Han, G. J.; Xing, Z.; Dong, Y. H.; Zhang, S. C.; Zhang, X. R. Angew. Chem.-Int. Edit. 2011, 50, 3462-3465. (19) Bandura, D. R.; Baranov, V. I.; Ornatsky, O. I.; Antonov, A.; Kinach, R.; Lou, X. D.; Pavlov, S.; Vorobiev, S.; Dick, J. E.; Tanner, S. D. Anal. Chem. 2009, 81, 6813-6822. (20) Bendall, S. C.; Simonds, E. F.; Qiu, P.; Amir, E. A. D.; Krutzik, P. O.; Finck, R.; Bruggner, R. V.; Melamed, R.; Trejo, A.; Ornatsky, O. I.; Balderas, R. S.; Plevritis, S. K.; Sachs, K.; Pe'er, D.; Tanner, S. D.; Nolan, G. P. Science 2011, 332, 687-696. (21) Angelo, M.; Bendall, S. C.; Finck, R.; Hale, M. B.; Hitzman, C.; Borowsky, A. D.; Levenson, R. M.; Lowe, J. B.; Liu, S. D.; Zhao, S.; Natkunam, Y.; Nolan, G. P. Nat. Med. 2014, 20, 436-442. (22) Giesen, C.; Wang, H. A. O.; Schapiro, D.; Zivanovic, N.; Jacobs, A.; Hattendorf, B.; Schuffler, P. J.; Grolimund, D.; Buhmann, J. M.; Brandt, S.; Varga, Z.; Wild, P. J.; Gunther, D.; Bodenmiller, B. Nat. Meth. 2014, 11, 417-422. (23) Frei, A. P.; Bava, F.-A.; Zunder, E. R.; Hsieh, E. W. Y.; Chen, S.-Y.; Nolan, G. P.; Gherardini, P. F. Nat. Meth. 2016, 13, 269-275. (24) Liu, R.; Zhang, S.; Wei, C.; Xing, Z.; Zhang, S.; Zhang, X. Acc. Chem. Res. 2016, 49, 775-83. (25) Liu, R.; Wu, P.; Yang, L.; Hou, X.; Lv, Y. Mass. Spectrom. Rev. 2014, 33, 373-93. (26) Liang, Y.; Yang, L. M.; Wang, Q. Q. Appl. Spectrosc. Rev. 2016, 51, 117-128. (27) Wang, H.; He, M.; Chen, B.; Hu, B. J. Anal. At. Spectrom.2017, 32, 1650-1659 (28) Hann, S.; Dernovics, M.; Koellensperger, G. Curr. Opin. Biotechnol.2015, 31, 93-100. 12


Page 12 of 22

Page 13 of 22 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(29) Sanz-Medel, A. Anal. Bioanal. Chem. 2016, 408, 5393-5395. (30) Rotaru, A.; Dutta, S.; Jentzsch, E.; Gothelf, K.; Mokhir, A. Angew. Chem.-Int. Edit. 2010, 49, 5665-5667. (31) Zhou, Z. X.; Du, Y.; Dong, S. J. Anal. Chem. 2011, 83, 5122-5127. (32) Zhang, L.; Zhao, J.; Duan, M.; Zhang, H.; Jiang, J.; Yu, R. Anal. Chem. 2013, 85, 3797-3801. (33) Wang, Z.; Si, L.; Bao, J.; Dai, Z. Chem. Commun. 2015, 51, 6305-6307. (34) Song, Q. W.; Shi, Y.; He, D. C.; Xu, S. H.; Ouyang, J. Chem. Eur. J. 2015, 21, 2417-2422. (35) Zhao, J.; Hu, S. S.; Cao, Y.; Zhang, B.; Li, G. X. Biosens. Bioelectron. 2015, 66, 327-331. (36) Zhang, S.; Han, G.; Xing, Z.; Zhang, S.; Zhang, X. Anal. Chem. 2014, 86, 3541-7. (37) Han, G. J.; Zhang, S. C.; Xing, Z.; Zhang, X. R. Angew. Chem.-Int. Edit. 2013, 52, 1466-1471. (38) May, T. W.; Wiedmeyer, R. H. Atom. Spectrosc.1998, 19, 150-155. (39) Hu, W. W.; Ning, Y.; Kong, J. M.; Zhang, X. J. Analyst 2015, 140, 5678-5684. (40) Song, C. X.; Yang, X. H.; Wang, K. M.; Wang, Q.; Huang, J.; Liu, J. B.; Liu, W.; Liu, P. Anal. Chim. Acta 2014, 827, 74-79. (41) Gao, F. L.; Lei, J. P.; Ju, H. X. Anal. Chem.2013, 85, 11788-11793. (42) Zhao, W.; Qin, Z.; Zhang, C.; Zhao, M.; Luo, H. Chem. Commun. 2014, 50, 9846-9848. (43) Wang, H. B.; Zhang, H. D.; Chen, Y.; Huang, K. J.; Liu, Y. M. Sens. Actuator B-Chem. 2015, 220, 146-153. (44) He, X. W.; Ma, N. Anal. Chem. 2014, 86, 3676-3681.

13



Table 1. The Operating Conditions of ICPMS Instrument. Conditions

Settings

Radiofrequency power

1300 W

Coolant argon gas flow

13 L min-1

Auxiliary argon gas flow

0.8 L min-1

Carrier ( Nebulizer) argon gas flow

1.0 L min-1

Resolution

0.7 amu

Dwelling time

30 ms

Dead time

50 ns

Sweeps per reading

5

Isotope monitored

63

Cu65Cu

14


Page 14 of 22

Page 15 of 22 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 2. Sequences of Oligonucleotides. Name

Sequence (5′−3′)

Capture DNA

NH2-(CH2)6-A10TATTAACTTTACTCC TCAGCGGGGAGGAAGGGAGTAAAG

Target DNA TTAATA TCAGCGGGGAGGAAGGGAGTAAAA SBM DNA TTAATA Non-complementary

GTGATCATACTTGGCAACTCGGTAC

DNA

CGCGC CTTCCTCCCCGCTGACAAAGTTCAG

Hairpin probe H1 CGGGG GTTTCAAGTCGCCCCGAAGGAGGG Hairpin probe H2 GCGACT a

SBM: Single base mismatch.

15



Page 16 of 22

Table 3. Comparison of label-free methods for DNA determination. Sensing unit

Assay type

Analytical method

LOD /pM References

Cu NPs

label-free

ICPMS

4

this work

Cu NPs

label-free

98

39

400

40

45

41

fluorescence spectrometry fluorescence Cu NPs

label-free spectrometry surface-enhanced

Ag NPs

label-free Raman spectroscopy liquid

Deoxyadenosine label-free

chromatography-mass 370

42

monophosphates spectrometry fluorescence Organic chromophore

label-free

10

43

10

44

spectrometry fluorescence Quantum dots

label-free spectrometry

Lanthanides

labeled

ICPMS

0.5-2

37

Au NPs

labeled

ICPMS

1

17

16


Page 17 of 22 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1. Schematic diagram of the proposed label-free bioassay for target DNA.

17



Figure 2. Templated formation of Cu NPs by double strand DNA. a, the ICPMS signal without target DNA and with hairpin DNAs (A in Fig. 2a), with target DNA and without hairpin DNAs (B in Fig. 2a), the target DNA and hairpin DNAs all present (C in Fig. 2a); b, TEM; c, ultraviolet-visible absorption spectrum; and d, fluorescence spectrum of the formed Cu NPs.

18


Page 18 of 22

Page 19 of 22 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3. ICPMS detection of Cu. a, the signal of 63Cu and 65Cu; b, the calibration curve of 63Cu.

19



Figure 4. The effect of the concentrations of copper sulfate (a) and sodium ascorbate (b).

20


Page 20 of 22

Page 21 of 22 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5. The Analytical Performance of the current label-free DNA assay. a, the calibration curve between target DNA concentration and 63Cu signal; b, the specific recognition of target DNA.

21



for TOC only

22


Page 22 of 22

Label-Free DNA Assay by Metal Stable Isotope Detection - Analytical

Recommend Documents