Magnetically assisted electrodeposition of aligned collagen coatings

Subscriber access provided by UNIV OF SCIENCES PHILADELPHIA

Characterization, Synthesis, and Modifications

Magnetically assisted electrodeposition of aligned collagen coatings Junjun Zhuang, Suya Lin, Lingqing Dong, Kui Cheng, and Wen-Jian Weng ACS Biomater. Sci. Eng., Just Accepted Manuscript • DOI: 10.1021/acsbiomaterials.7b01038 • Publication Date (Web): 30 Mar 2018 Downloaded from http://pubs.acs.org on March 31, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Biomaterials Science & Engineering

Magnetically assisted electrodeposition of aligned collagen coatings Junjun Zhuang1, Suya Lin1, Lingqing Dong1,2*, Kui Cheng1, Wenjian Weng1* 1.School of Materials Science and Engineering, State Key Laboratory of Silicon Materials, Zhejiang University, Hangzhou 310027, China. 2.The Affiliated Stomatologic Hospital, School of Medicine, Zhejiang University, Hangzhou 310003, China. *Correspondence and requests for materials should be addressed to: [email protected] and [email protected]

Abstract Well-aligned collagen

nanofibers are crucial in engineering bioinspired

regenerative strategies, such as bone, muscle and cornea. However, keeping the natural bioactive of collagen and controlling its orientation in a coating still remain a challenge. Here we present a novel magnetically assisted electrochemical technique to deposit type-I collagen nanofibers with high alignment onto titanium. The magnetic assistance involved mainly the incorporation of iron oxide nanoparticles (IOPs) and the application of an external magnetic field during the electrochemical deposition. The combination of IOPs with the collagen nanofibrils in electrolyte endowed the nanofibrils with magnetism, which forced the collagen nanofibrils to be straightened and assembled into aligned nanofibers under magnetic field during electrodeposition. The influence of the applied magnetic field on orientational order of the collagen

1

ACS Paragon Plus Environment

ACS Biomaterials Science & Engineering 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 26

nanofibers in the coatings extended to drying stage. The aligned collagen coatings demonstrated to favorably guide the bone marrow mesenchymal stem cells (BMSCs) grow in the form of elongated morphology, which promoted the cellular osteogenic differentiation dramatically. The present magnetically assisted electrodeposition could emerge as an attractive approach to fabrication of aligned nanofibers on substrates for subsequent uses such as bone tissue engineering.

Key words: aligned collagen coating, magnetically assisted electrodeposition, IOPs assembly, osteogenic differentiation

1. Introduction Structural anisotropy is an essential impact in the inherent function of numerous tissues. Structural single orientation imparts crucial mechanical strength to some tissues: cardiac muscle, tendons, and ligaments, which is load-beared.1-8 Extracellular matrix alignments also guide direction for cells migration and processes, which plays a key role in wound healing, and tissue regeneration.9-10 Tissue engineering strategies, combining structural anisotropy, are vital in the evolution of the biomaterials produced by synthetic materials as well as natural polymers, such as collagen.11-15 Type I collagen, which is the most abundant and important structural protein in vertebrates, is the major component of the extracellular matrix in a variety of tissues including bone, dentin, tendons, cartilage, and cornea. It has been extensively

2


Page 3 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


researched and found to be an excellent facilitator of cell attachment, proliferation, and differentiation.16 Native fibrous type I collagen is aligned in parallel arrays in many types of tissues, either locally or extensively.17 Such aligned collagen can act as a guidance for neural cell migration and directional axonal regeneration, as well as contributes to soft tissue functions of articular cartilage, and arterial wall.18-19 Furthermore, aligned collagen coatings has frequently been employed in the engineering of surfaces for the designed functions, such as releasing the proteins and growth factors in a guided fashion or tuning the biochemical signals spatially and geometrically.20-22 So it is highly expectant to establish aligned collagen coatings to mimic the native environment onto the substrate. Improvements in collagen fiber quality has been achieved in recent years through a variety of fiber fabrication techniques, which have been previously developed to engineer materials with precisely defined features and also have different advantages and shortcomings.23-28 Electrospinning can generate highly aligned fibers taking collagen as a solution, simply and easily. Nevertheless, the labile solvents, rigorous electrical fields have been proved to change collagen’s native structure irreversibly, leading to denatured gelatin.29 Extrusion of collagen from microfluidic channels into aqueous solutions is an alternative system for the production of aligned fibers, but the complicated device and the required high concentration of collagen solution make it be limited in some situations.30-32 Shear flow deposition also can align collagen on the substrate whereas it will be thin with low bonding strength.33 Electrocompaction is

3



Page 4 of 26

also utilized for fabricating the composite fibers of collagen and other polymers, but the fibers form in the electrolyte rather than on the substrate.34 Electrochemical deposition is a mild and promising method for the collagen deposition on the substrate. It is extremely efficient, inexpensive, and enables feasible incorporation of additional components to make composite nanofibers.35-37 Magnetic nanoparticles are a class of materials that are particularly well suited for the biomedical applications. Therefore, in this study, we proposed a feasible electrodeposition method to engineer the well-aligned collagen coatings on the Ti substrate with the assistance of collagen magnetization and applied magnetic fields during the deposition and drying process. The collagen nanofibers diameter and orientational order were characterized and the cellular responses to the aligned collagen coatings were also evaluated. Moreover, the magnetically-assisted electrodeposition mechanism was also proposed.

2. Materials and methods 2.1 Preparation of aligned collagen coatings Type I collagen (Beijing Yierkang Co.) solution (0.5 mg/mL) was prepared in acetic acid (5 mM), and stored at 4 °C. Ca(NO3)2 and NH4H2PO4 solution (80 mM) were prepared in distilled water. The collagen，Ca(NO3)2 and NH4H2PO4 solutions were mixed for a final concentration of 8 mM for Ca2+ and PO43−, 0.4 mg mL-1 for collagen as an electrolyte. Iron oxide nanoparticles (IOPs, Nanjing Nanoeast Biotech Co.) (0.4 mg mL-1) with terminal amino were modified by polyethylene glycol (PEG),

4


Page 5 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


and dispersed in distilled water, then were mixed into the above electrolyte to make the final mass ratios of IOPs and collagen were 0, 0.5, 0.67, 1, respectively. Alkaline solution (NH3·H2O, 0.25 M) was utilized to adjust the pH of the electrolyte (4.4-4.5). Ti plates were cut into pieces (10 mm × 20 mm × 0.1 mm). Ti plates were cleaned by mixed acid and stored as described before.35 The random collagen coatings (MC) were obtained by electrodeposition without the aid of magnetic field using alternating potentials assisted electrochemical deposition that proposed by our group before. 35 For the aligned coating, the magnetic field was applied parallelly to the plane of the substrate by the ring magnet with the intensity of 50 mT. After deposition, the coating was placed in the uniform magnetic field generated by two magnets with the intensity of 100 and 300 mT. The electrolyte without IOPs was utilized for preparing the mineralized collagen coatings (MC).

2.2 Characterizations of coatings The surface morphology and microstructure of the coatings were observed by scanning electron microscope (SEM; Hitachi, S-4800, SU-70). The deposited samples were dried at 37 °C and gold-sputtered before test, and the phase of the components was characterized by XRD (X-pert Powder, PANalytical B.V.) using Cu Kα radiation source (λ= 1.54 Å) at 35 kV with a scan rate of 2 min-1. The shear strength between coatings and substrates was measured by universal testing machine with 3 M adhesive tapes (Minnesota Mining and Manufacturing,

5



Page 6 of 26

3M610). The samples were cut into the size of 10 mm × 10 mm × 0.1 mm, and the tape was stuck onto the coating tightly with the size of 20 mm × 10 mm. The schematic diagram was mentioned in the research of our previous work.38 The strain rate was 2 % s-1. Three replicated samples were characterized for all coatings.

2.3 Content of components in the coatings Different coatings were dissolved with hydrochloric acid (3M) at 37°C for 2h. The concentrations of Ca2+, Fe2+ and Fe3+ were detected by an inductively coupled plasma mass spectrometer (ICP-MS, Thermo Fisher Scientific XSENIES, Waltham, MA). The collagen content was confirmed by BCATM Protein Assay Kit (Thermo Scientific), the absorbance was measured on a microplate reader (Thermo, Multiskan MK3) at 560 nm and the corresponding collagen concentration was calculated based on the calibration curve obtained.

2.4 In vitro tests 2.4.1 Cell culture and seeding Mesenchymal stem cells (MSCs) were isolated and collected from Sprague-Dawley (SD) rats. The animal protocol was approved by the Ethics Committee for Animal Research, First Affiliated Hospital of Medical College, Zhejiang University. The cell culture protocol was followed by the previous work.39 MSCs were cultured in alpha-modified Minimum Essential Medium (MEM Alpha, Gibco) supplemented with 10% fetal bovine serum (FBS, PAA), 1% sodium pyruvate, 1% antibiotic 6


Page 7 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


solution containing 10,000 units mL-1 penicillin and 10,000 µg mL-1 streptomycin, and 1% MEM non-essential amino acids (all from Gibco) under a humidified atmosphere of 5% CO2 at 37 oC. Subconfluent MSCs growing on tissue culture polystyrene (TCPS) were trypsinized with 0.25% trypsin, 1 mM EDTA (Gibco), and were subcultured on different coatings. Before cell seeding and culture, the subtrates (10 mm × 20 mm × 0.1 mm) were cut into smaller size of 10 mm × 10 mm × 0.1 mm. The samples were sterilized by ultraviolet for 30 min and converted into 24-well plate，then inoculated into a 24-well plate with a density of 1 × 105 cells mL-1 in cell suspension (500 µL). Initial adhesion of BMSCs on various coatings was evaluated after incubation for 24 h. Proliferation of cells were quantified as cell density at day 3. After 1 day and 3 days, samples were placed in a new 24-well plate and washed 3 times. 500 µL fresh culture media and 50 µL of cell counting kit-8 (CCK-8, Dojindo Laboratories, Kumamoto, Japan) solution were inoculated into each well and incubated for 3 h (37 °C). Finally, 120 µL of the culture media were added into a new 96-well plate at the indicated times, and colorimetric tests of formazan dye were measured by a microplate reader at 450 nm.

2.4.2 Cell morphology For observing the morphology of the cells, SEM was used. After removing the culture medium, the cells were fixed with 3.7% PBS/paraformaldehyde (RT, 30 min) after 24 h. The fixed samples were dehydrated in graded alcohols (50, 75, 90, 95,

7



Page 8 of 26

100%) for 15 min, and then were finally dehydrated with liquid CO2 in critical point dryer (Hitachi Model Hcp-2). The cell morphology on the specimen was finally observed at 3 kV after gold sputtering. Confocal laser scanning microscopy (CLSM) was applied to observe cytoskeletal arrangement on various coatings. After 24 h, the culture medium was removed and every sample was washed twice with 500 µL 0.05% tween/PBS, and then fixed in 3.7% buffered paraformaldehyde (PFA, 15min, T). The cells were washed three times for 5 min in PBS and permeabilized with PBS containing 0.4% Triton X-100 for 15 min at room temperature. After blocking in PBS with 12% fetal bovine serum (FBS) and 2% bovine serum albumin (BSA) for 1 h at room temperature, the cells were washed twice with 500µL 0.05% tween/PBS. Cells were stained with a 50 µg mL-1 fluorescent

phalloidin

conjugate

solution

and

50

µg

mL-1

4,6-diamidino-2-phenylindole (DAPI) in PBS for 40 minutes at room temperature. The actin arrangement was finally examined by CLSM (TCS SP5, LEICA, Germany). The Cell Profiler software was used to quantitate the cell orientation. The degree of cell orientation was characterized by the angular standard deviation, SD (σ), as descripted in the other work.40

2.4.3 ALP, COL-I and OCN activity assay The BMSCs (5.0 × 104 cells/mL) were seeded on the samples, and the culture medium was refreshed for every 2 days. At the 4th day, the medium was changed to

8


Page 9 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


osteogenic induction medium containing vitamin C (1 mM), dexamethasone (10 mM), sodium beta-glycerophosphate (1 mM) in basal culture medium. After culturing for 7,14 and 21 days, the culture medium was removed, and the samples were washed three times with PBS，then were transferred to a new culture plates. The CelLytic Buffer (Sigma, St. Louis) was added into every well to lyse cells. The cell lysate was centrifuged (4 °C, 15 min) with the rotational speed of 12000 rmp, and aliquots of supernatants were collected for ALP (7, 14 days) and COL-I, OCN (14, 21 days) activity measurement. The ALP quantity was assayed by LabAssayTM ALP (Wako Pure Chemical Industries, Ltd. Japan) via measuring the OD value at 405 nm and the COL-I, OCN quantity was determined with COL-I and OCN ELISA kits via measuring the OD value at 450 nm. ALP, OCN and COL-I activities were obtained by normalizing the quantitative assay values to total protein amount tested in BCA protein assay.

2.4.5 Quantitative Real-Time PCR Assay The expressions of related genes were examined through real-time (RT) polymerase chain reaction (PCR) assay. The total RNA was extracted by TRIzol reagent and the cDNA was reverse-transcribed from 150 ng of RNA. RT-PCR was conducted on the Mastercycler ® ep realplex with a SYBR Green I matermix. The relative expressions of osteogenesis-related genes (Runx2, BMP-2, COL-I, OCN) was normalized to that of the reference gene β-actin. The primers for target genes were

9



Page 10 of 26

shown in Table 1.

Table 1. The primers used for real-time PCR Primers

Sequence (5’ to 3’)

Runx-2

F: GCCACTTACCACAGAGCTATTA R: GGCGGTCAGAGAACAAACTA

BMP-2

F: TGTGAGGATTAGCAGGTCTTTG R: TTGTGGAGTGGATGTCCTTTAC

COL-I

F: ACTGGTACATCAGCCCAAAC R: GGAACCTTCGCTTCCATACTC

OCN

F: TGACTGCATTCTGCCTCTC R: CGGAGTCTATTCACCACCTTAC

β-actin

F: ACAGGATGCAGAAGGAGATTAC R: ACAGTGAGGCCAGGATAGA

2.5 Statistical analysis Statistical analyses were tested by one-way analysis of variance (one-way ANOVA) and the Student's t-test was performed to determine the significant differences between the groups. All values are expressed as mean ± standard deviation. Differences were shown statistically significant when P < 0.05, P < 0.01 and P < 0.001.

10


Page 11 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


3. Results 3.1 Isoelectric point of electrolyte Although positively charged in the electrolyte, the IOPs and collagen nanofibrils would interact with each other because there are negatively charged residues on collagen nanofibrils as an amphoteric molecule. So the isoelectric point of the electrolyte was detected with a view to its importance to the deposition behavior of the mixture. As shown in Fig. 1, the zeta potential of the electrolyte changed from positive to negative as the pH increased from 3-8, and the isoelectric point should appear between 7-8, which was a little higher than that of the pure collagen (pI=6.5) we used, indicating the possible interaction between the amino groups of the IOPs and the carboxyl groups on the collagen nanofibrils.

Fig. 1. Zeta potential of IOPs and collagen mixed solutions under different pH.

3.2 Characterizations of aligned collagen coatings To explore the effect of IOPs amount on the collagen alignment, the surface morphologies of coatings prepared with different mass ratios of IOPs and collagen in the electrolytes were characterized. The collagen could be aligned when incorporated 11



Page 12 of 26

with the IOPs and exposed to the static magnetic field (H1=50 mT) during the deposition process (Fig. 2). And as the increasing amount of IOPs in the electrolyte, the decreased collagen nanofiber diameter was observed and the diameter ranged from 300 nm-2 µm. The calcium phosphate on the surface was also gradually reduced with more exposed collagen. These results demonstrated the IOPs restrained the deposition of calcium phosphate on the collagen nanofibers, resulting the reductive mineralization degree. Furthermore, to keep the alignment of collagen nanofibers after drying, the application of magnetic field was also necessary, which was revealed in the Fig. 3. As the magnetic field altered from 0-300 mT (H2) with the mass ratio of IOPs and collagen was 1, the collagen nanofibers were better organized with the higher intensity (Fig. 3a-c), which also confirmed the role of the magnetic field to maintain the orientation in the drying process. However, when the H1 was withdrew, there was no aligned collagens observed on the coatings even if the H2 was reached 300 mT (Fig. 3d, e), illustrating the predominance of H1 in the collagen alignment.

Fig. 2. Effect of the IOPs amount on the collagen fiber diameter. The SEM images of coatings with different mass ratios of IOPs and collagen, (a) 0, (b) 0.5, (c) 0.67, (d) 1. The magnetic field was 50 mT during the deposition and 300 mT during drying. Scale bar: 2µm.

The magnetic field with different duration (10 min, 23 min, 32 min) in the deposition process was applied for predicating at which step alignment occurred. As 12


Page 13 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


we can see from Fig. 4, the applied magnetic field caused the decreased HA content and increased IOPs amount with the longer duration time (Fig. 4a, b), followed by the same trend of the bonding strength of the coatings with the substrate (Fig. 4c, d). The coating prepared without SMF showed the highest shear strength (3.5 MPa), and as the increased duration time of SMF, the shear strength decreased all the time, which demonstrated that the weaker mineralization of the coating was accompanied with the longer duration time of H1 because the calcium phosphate was the binding agent between coating and substrate. More interestingly, the IOPs content in the coating was also reduced as the application of magnetic field. It seemed that the magnetic field restrained the movement of the IOPs to the substrate.

Fig. 3. Effect of magnetic field intensity on the orientational order of collagen nanofibers. The SEM images of coatings with different intensity of magnetic field during deposition and drying process, (a) 50/0, (b) 50/100, (c) 50/300, (d) 0/100, (e) 0/300. Scale bar: 4µm.

13



Page 14 of 26

Fig. 4. Duration time of magnetic field on the aligned collagen coatings. (a) The mass ratios of HA and collagen in coatings with different duration time of magnetic field, (b) The mass ratios of IOPs and collagen in coatings with different duration time of magnetic field, (c-d) Bonding strength (c) and shear strength curve (d) of coatings with different duration time of magnetic field. *p < 0.05, **p < 0.01.

Fig. 5. The characterizations of typical samples. (a-d) The SEM images of typical samples, (a) random coating, the inset is the Fast Fourier Transformation (FFT) image of random coating, (b) aligned coating, the inset is the Fast Fourier Transformation (FFT) image of aligned coating (c) cross-section of random coating, (d) cross-section of aligned coating, (e) XRD analysis of different coatings. Scale bar: 4µm.

3.3 Cell response to the aligned collagen coating 14


Page 15 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


To explore the potential osteogenesis of the aligned collagen coating, we further carried out in vitro evaluation of adhesion, proliferation, and differentiation of BMSCs. Two typical coatings: random and aligned, (Fig. 5a, b) with the similar thickness (Fig. 5c, d) was chosen and mass ratio of IOPs and collagen was set as 1 because the lower mineralization was beneficial to support cell function. The XRD results in Fig. 5e revealed that the IOPs incorporation decreased the crystal content of calcium phosphate in the collagen coating, no matter random or aligned, compared to the coating without IOPs (MC). The two typical random and aligned coating showed the similar mineralization degree. Cell adhesion behavior on two coatings was observed by SEM and CLSM imaging (Fig. 6a) after 1 day. BMSCs presented well cell adhesion and widely spread morphology on both coatings with significant difference. BMSCs distributed randomly throughout the random collagen coatings, forming more polygonal in shape with short focal-adhesion extensions. Conversely, BMSCs showed gracile shape on the aligned collagen coatings, and stretched distinctly along the long axis of the nether collagen nanofibers. Cellular cytoskeleton organization was also dominated by the prevailing nanofiber orientation. Cells presented an elongated F-actin bundles and protrusions preferentially parallel to fiber orientation on aligned coatings. In contrast, cells presented a cytoskeleton organization with no preferred arrangement of actin filaments. The arranged structure of the coating had a significant effect on cell alignment, which was revealed by quantitative evaluation. Fig. 6b showed the distribution of cell orientation on each

15



Page 16 of 26

coating. The cell orientation degree was much lower on the aligned coating than that on random coating, demonstrating that the cell alignment was strongly controlled by the periodicity of the coating. Also cytomorphometric evaluations of the area, perimeter, and Feret’s diameter further indicated a considerable regulation in cell spread and cytoskeletal development on aligned coating (Fig. 6c).

Fig. 6. The cell morphology on typical random and aligned coatings. (a) The SEM images and CLSM images of actin (red) and nucleus (blue) of BMSCs on random and aligned coatings. (b) Cell orientation against surface periodicity was quantified at 10°. (c) Cytomorphometric evaluations of area, perimeter and Feret’s diameter, respectively.

The significant difference in cell morphology leaded to the better cell adhesion and proliferation (Fig. 7a) on the aligned collagen coatings. Meanwhile, the cell morphology supports diverse cell function, relying on the forces to the cell’s nucleus which then regulate transcription. Hence, the ALP, COL-I and OCN activity were 16


Page 17 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


measured to present the osteogenic differentiation of BMSCs on both coatings (Fig. 7b-d). The ALP level of BMSCs on the aligned collagen coating was always higher (by approximately 30% at 7d and 60% at 14d) than that of random coating over the incubation time from 7 to 14 days. The increase in ALP expression indicates the increased differentiation of cells cultured on the aligned coating. This increase is thought to play a key role in subsequent osteogenesis: ALP induces matrix secretion and calcium phosphate deposition (mineralization) afterwards. Fig. 7c and 7d showed the COL-I and OCN activity after 14 and 21 days. The COL-I secretion increased by 16% and 40% on the aligned collagen coating compared to the random coating at day 14 and 21, respectively. There was no significant difference between the OCN activity on both coatings at day 14, but it was still higher (by 42%) on the aligned coatings than that on the random coatings and the measured increase in OCN for aligned coatings may also be due to preferred mineral nucleation on the longer cell extensions. The deferred difference might be attributed to that OCN is the terminal indicator of osteogenic differentiation. Then the quantified expression levels of osteogenesis-related genes: Runx-2, BMP-2, COL-I and OCN on the two samples by real-time PCR were evaluated and shown in Fig. 7e. Cells on aligned collagen coating were observed with significantly higher expressions all of osteogenesis-related genes. Cells on the random coating showed minor expressions of osteogenesis-related genes particularly on day 14.

17



Page 18 of 26

Fig. 7. Osteogenic differentiation of BMSCs on typical coatings. (a-d) The cytocompatibility and osteogenic differentiation on different coatings, (a) cell adhesion and proliferation, (b) ALP activity, (c) COL activity, (d) OCN activity. (e) Quantitative polymerase chain reaction (PCR) analysis for relative gene expression of osteogenic differentiation markers: Runx-2, BMP-2, COL-I and OCN, *p < 0.05, **p < 0.01.

4. Discussion During magnetically assisted electrodeposition process, the magnetic nanoparticles (IOPs) demonstrated a role in adjusting average fiber diameters in the coatings to vary from 300 nm to 2 µm by increasing the mass ratios of IOPs and collagen from 0.5 to 1 (Fig. 2). And the applied magnetic field significantly affected the order of collagen nanofibers in the coating, the orientational order was intensified as the magnetic field intensity varied from 0 to 300 mT (Fig. 3). The resulting coatings with an anisotropic collagen nanofiber structure mediated BMSCs to grow unidirectionally with an elongated cellular morphology (Fig. 6) which significantly upregulated cellular osteogenic differentiation (Fig. 7). Hence, the magnetic aid in this study generated the

18


Page 19 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


aligned collagen coating on the substrate and subsequently its better biological performance. For collagen coating electrodeposition mechanism proposed in our previous work,41 three main steps are involved. (1) Collagen nanofibrils self-assembly. Positively charged collagen nanofibrils in the electrolyte are driven towards the cathode under the electric field, and begin to self-assemble into nanofibers nearby the cathode due to the pH increase derived from H2O electrolysis. (2) Collagen mineralization. Since the carboxylate groups of collagen serve as key nucleation sites for CaP crystals, the high pH near the cathode facilitates mineralization in the collagen nanofibers. (3) Mineralized collagen deposition. Subsequently, the deposition of the mineralized collagen nanofibers onto the cathode accrued. When IOPs and magnetic field are integrated into the deposition mentioned above, the magnetic aid for aligning collagen coating is suggested to take place in the first two steps (Fig. 8). Firstly, the collagen nanofibrils were magnetized after the combination with IOPs in the electrolyte as the form of IOPs-COL species. Because of the interaction of the negatively charged groups on collagen nanofibrils with the positively charged amino groups on the IOPs surface, the isoelectric point (pI) of the collagen solution increase from 6.5 to more than 7 (Fig. 1). Secondly, the IOPs-COL species are forced to straighten parallelly to the direction of applied magnetic field due to strong magnetic dipole-dipole interactions among IOPs which generates the attractive force parallel to the direction of H1 and repulsive force vertical to the

19



Page 20 of 26

direction of H1.42 The straightened IOPs-COL species are driven to approach to the cathode by electrical force, and aggregate (self-assembly) into aligned nanofibers at the pI plane, then deposit onto the substrate to form aligned collagen coatings. An increase in IOPs incorporation amount endows collagen nanofibrils with stronger magnetism, and makes the alignment more easily (Fig. 2). The repulsive forces between IOPs prevent nanofibrils assembling into the collagen nanofibers to some extent, leading to the smaller nanofiber diameter and weaker mineralization, as well as lower coating adhesive strength (Fig. 4c, d). Due to swelling property of collagen coatings, the magnetic filed should be maintained as an aligning force until the coating has dried. The orientational order of the collagen nanofibers in the coatings shows sensitivity to the intensity and duration of the magnetic field (H2) in the drying process (Fig. 3) because the collagen nanofibers in as-deposited coatings are larger than the initial nanofibrils in electrolyte and packed very closely, thus the higher magnetic field intensity is required to maintain orientational order of nanofibers, which shows the essential role of H2 in the collagen alignment. When BMSCs are seed on the aligned collagen coatings, the collagen nanofibers guide the cells to grow along the nanofiber direction to form elongated morphology (Fig. 6), with the afterwards promoted cell adhesion, proliferation and differentiation, as well as mRNA expression of osteogenic markers (Fig. 7). As is well-known, cell spreading is partially guided by focal adhesions that form and distribute between cells

20


Page 21 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


and materials, mediated by integrins on the cell membrane.43 Previous studies have demonstrated that nanofiber alignment-induced formation of focal adhesion might mainly appear on the front edge of the elongated cells and parallel to the aligned nanofibers, which in turn resulted in the elongation of F-actin along the fiber direction, followed by the changes of genes transcriptions.44-45 We therefore speculated the up-regulated osteogenic genes expression may be attributed to the alignment of the integrin-mediated actin elongation and arrangement.

Fig. 8. The schematic diagram of deposition process

5. Conclusions In this study, we have

developed a

magnetically assisted chemical

electrodeposition to form aligned collagen nanofibers coatings. The collagen nanofibrils magnetization by combination of IOPs in electrolyte and the magnetized nanofibrils straightening by external magnetic field during deposition both contributed to the alignment of collagen nanofibrils. It is also necessary to apply 21



Page 22 of 26

magnetic field onto drying stage of as-deposited coatings for maintaining the orientational order of collagen nanofibers. The aligned collagen coatings significantly upregulated the osteogenic differentiation of BMSCs due to the induced cellular elongated morphology. We believe the present deposition strategy is a promising technique to fabricate controllable aligned nanofiber arrays for applications in tissue engineering.

Acknowledgements This work is financially supported by National Natural Science Foundation of China (51772273, 51472216, 51502262), the 111 Project under Grant No. B16042, and the Postdoctoral Science Foundation of China (Grant No. 2017M621923).

References

1. Li, M.; Dickinson, C. E.; Finkelstein, E. B.; Neville, C. M.; Sundback, C. A., The Role of Fibroblasts in Self-Assembled Skeletal Muscle. Tissue Eng., Part A 2011, 17 (21-22), 2641-2650. DOI: 10.1089/ten.TEA.2010.0700. 2. Khan, M.; Xu, Y. Y.; Hua, S.; Johnson, J.; Belevych, A.; Janssen, P. M. L.; Gyorke, S.; Guan, J. J.; Angelos, M. G., Evaluation of Changes in Morphology and Function of Human Induced Pluripotent Stem Cell Derived Cardiomyocytes (HiPSC-CMs) Cultured on an Aligned-Nanofiber Cardiac Patch. Plos One 2015, 10 (5),e0126338. DOI: 10.1371/journal.pone.0126338. 3. Liu, Y. W.; Lu, J. F.; Li, H. N.; Wei, J. J.; Li, X. H., Engineering blood vessels through micropatterned co-culture of vascular endothelial and smooth muscle cells on bilayered electrospun fibrous mats with pDNA inoculation. Acta Biomater. 2015, 11 (1), 114-125. DOI: 10.1016/j.actbio.2014.10.004. 4. Kobayashi, M.; Lei, N. Y.; Wang, Q. Q.; Wu, B. M.; Dunn, J. C. Y., Orthogonally oriented scaffolds with aligned fibers for engineering intestinal smooth muscle. Biomaterials 2015, 61 (1), 75-84. DOI: 10.1016/j.biomaterials.2015.05.023.

22


Page 23 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


5. Chen, H. B.; Qian, Y. Z.; Xia, Y.; Chen, G.; Dai, Y.; Li, N.; Zhang, F. M.; Gu, N., Enhanced Osteogenesis of ADSCs by the Synergistic Effect of Aligned Fibers Containing Collagen I. Acs Appl. Mater. Inter. 2016, 8 (43), 29289-29297. DOI:10.1021/acsami.6b08791. 6. Perikamana, S. K. M.; Lee, J.; Ahmad, T.; Jeong, Y.; Kim, D. G.; Kim, K.; Shin, H., Effects of Immobilized BMP-2 and Nanofiber Morphology on In Vitro Osteogenic Differentiation of hMSCs and In Vivo Collagen Assembly of Regenerated Bone. Acs Appl. Mater. Inter. 2015, 7 (16), 8798-8808. DOI: 10.1021/acsami.5b01340. 7. Li, H. Q.; Wen, F.; Chen, H. Z.; Pal, M.; Lai, Y. K.; Zhao, A. Z.; Tan, L. P., Micropatterning Extracellular Matrix Proteins on Electrospun Fibrous Substrate Promote Human Mesenchymal Stem Cell Differentiation Toward Neurogenic Lineage. Acs Appl. Mater. Inter. 2016, 8 (1), 563-573. DOI: 10.1021/acsami.5b09588. 8. Breidenbach, A. P.; Gilday, S. D.; Lalley, A. L.; Dyment, N. A.; Gooch, C.; Shearn, J. T.; Butler, D. L., Functional tissue engineering of tendon: Establishing biological success criteria for improving tendon repair. J. Biomech. 2014, 47 (9), 1941-1948. DOI: 10.1016/j.jbiomech.2013.10.023. 9. Nikkhah, M.; Eshak, N.; Zorlutuna, P.; Annabi, N.; Castello, M.; Kim, K.; Dolatshahi-Pirouz, A.; Edalat, F.; Bae, H.; Yang, Y. Z.; Khademhosseini, A., Directed endothelial cell morphogenesis in micropatterned gelatin methacrylate hydrogels. Biomaterials 2012, 33 (35), 9009-9018. DOI: 10.1016/j.biomaterials.2012.08.068. 10. Cornwell, K. G.; Pins, G. D., Enhanced Proliferation and Migration of Fibroblasts on the Surface of Fibroblast Growth Factor-2-Loaded Fibrin Microthreads. Tissue Eng., Part A 2010, 16 (12), 3669-3677. DOI:10.1089/ten.TEA.2009.0600. 11. Bettinger, C. J.; Langer, R.; Borenstein, J. T., Engineering Substrate Topography at the Micro- and Nanoscale to Control Cell Function. Angew. Chem. Int. Edit. 2009, 48 (30), 5406-5415. DOI:10.1002/anie.200805179. 12. Zhao, Z. G.; Fang, R. C.; Rong, Q. F.; Liu, M. J., Bioinspired Nanocomposite Hydrogels with Highly Ordered Structures. Adv. Mater. 2017, 29 (45), 1703045. DOI: 10.1002/adma.201703045. 13. Dahlin, R. L.; Kasper, F. K.; Mikos, A. G., Polymeric Nanofibers in Tissue Engineering. Tissue Eng., Part B, 2011, 17 (5), 349-364. DOI: 10.1089/ten.TEB.2011.0238. 14. Yang, Y.; Chen, Z. Y.; Song, X.; Zhang, Z. F.; Zhang, J.; Shung, K. K.; Zhou, Q. F.; Chen, Y., Biomimetic Anisotropic Reinforcement Architectures by Electrically Assisted Nanocomposite 3D Printing. Adv. Mater. 2017, 29 (11), 1605750. DOI: 10.1002/adma.201605750. 15. Jana, S.; Levengood, S. K. L.; Zhang, M. Q., Anisotropic Materials for Skeletal-Muscle-Tissue Engineering. Adv. Mater. 2016, 28 (48), 10588-10612. DOI: 10.1002/adma.201600240. 16. Antoine, E. E.; Vlachos, P. P.; Rylander, M. N., Review of Collagen I Hydrogels for Bioengineered Tissue Microenvironments: Characterization of Mechanics, Structure, and Transport. Tissue Eng., Part B 2014, 20 (6), 683-696. DOI: 23



Page 24 of 26

10.1089/ten.TEB.2014.0086. 17. Ramasamy, J. G.; Akkus, O., Local variations in the micromechanical properties of mouse femur: The involvement of collagen fiber orientation and mineralization. J. Biomech. 2007, 40 (4), 910-918. DOI: 10.1016/j.jbiomech.2006.03.002. 18. Martens, W.; Sanen, K.; Georgiou, M.; Struys, T.; Bronckaers, A.; Ameloot, M.; Phillips, J.; Lambrichts, I., Human dental pulp stem cells can differentiate into Schwann cells and promote and guide neurite outgrowth in an aligned tissue-engineered collagen construct in vitro. Faseb. J. 2014, 28 (4), 1634-1643. DOI: 10.1096/fj.13-243980. 19. Nakayarna, K. H.; Hong, G. S.; Lee, J. C.; Patel, J.; Edwards, B.; Zaitseva, T. S.; Paukshto, M. V.; Dai, H. J.; Cooke, J. P.; Woo, Y. J.; Huang, N. F., Aligned-Braided Nanofibrillar Scaffold with Endothelial Cells Enhances Arteriogenesis. Acs Nano 2015, 9 (7), 6900-6908. DOI: 10.1021/acsnano.5b00545. 20. Xie, J. W.; Li, X. R.; Xia, Y. N., Putting Electrospun Nanofibers to Work for Biomedical Research. Macromol. Rapid Commun. 2008, 29 (22), 1775-1792. DOI: 10.1002/marc.200800381. 21. Chew, S. Y.; Mi, R. F.; Hoke, A.; Leong, K. W., Aligned protein-polymer composite fibers enhance nerve regeneration: A potential tissue-engineering platform. Adv. Funct. Mater. 2007, 17 (8), 1288-1296. DOI: 10.1002/adfm.200600441. 22. Chen, X. N.; Fu, X. L.; Shi, J. G.; Wang, H. J., Regulation of the osteogenesis of pre-osteoblasts by spatial arrangement of electrospun nanofibers in two- and three-dimensional environments. Nanomed. Nanotechnol. 2013, 9 (8), 1283-1292. DOI: 10.1016/j.nano.2013.04.013. 23. Cheng, X. G.; Gurkan, U. A.; Dehen, C. J.; Tate, M. P.; Hillhouse, H. W.; Simpson, G. J.; Akkus, O., An electrochemical fabrication process for the assembly of anisotropically oriented collagen bundles. Biomaterials 2008, 29 (22), 3278-3288. DOI: 10.1016/j.nano.2013.04.013. 24. Wray, L. S.; Rnjak-Kovacina, J.; Mandal, B. B.; Schmidt, D. F.; Gil, E. S.; Kaplan, D. L., A silk-based scaffold platform with tunable architecture for engineering critically-sized tissue constructs. Biomaterials 2012, 33 (36), 9214-9224. DOI: 10.1016/j.biomaterials.2012.09.017. 25. Stoppel, W. L.; Hu, D. J.; Domian, I. J.; Kaplan, D. L.; Black, L. D., Anisotropic silk biomaterials containing cardiac extracellular matrix for cardiac tissue engineering. Biomed. Mater. 2015, 10 (3), 034105. DOI: 10.1088/1748-6041/10/3/034105. 26. Madaghiele, M.; Sannino, A.; Yannas, I. V.; Spector, M., Collagen-based matrices with axially oriented pores. J. Biomed. Mater. Res., Part A 2008, 85a (3), 757-767. DOI: 10.1002/jbm.a.31517. 27. Chamberlain, L. J.; Yannas, I. V.; Arrizabalaga, A.; Hsu, H. P.; Norregaard, T. V.; Spector, M., Early peripheral nerve healing in collagen and silicone tube implants: Myofibroblasts and the cellular response. Biomaterials 1998, 19 (15), 1393-1403. DOI: 10.1016/S0142-9612(98)00018-0.

24


Page 25 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


28. Lowe, C. J.; Reucroft, I. M.; Grota, M. C.; Shreiber, D. I., Production of Highly Aligned Collagen Scaffolds by Freeze-drying of Self-assembled, Fibrillar Collagen Gels. Acs Biomater. Sci. Eng. 2016, 2 (4), 643-651. DOI: 10.1021/acsbiomaterials.6b00036. 29. Dong, B.; Arnoult, O.; Smith, M. E.; Wnek, G. E., Electrospinning of Collagen Nanofiber Scaffolds from Benign Solvents. Macromol. Rapid Commun. 2009, 30 (7), 539-542. DOI: 10.1002/marc.200800634. 30. Sant, S.; Coutinho, D.; Gaharwar, A.; Gaharwar, A.; Neves, N.; Reis, R.; Gomes, M.; Khademhosseini, A. Self-Assembled Hydrogel Fiber Bundles from Oppositely Charged Polyelectrolytes Mimic Micro-/Nanoscale Hierarchy of Collagen. Adv. Funct. Mater. 2017, 27 (36), 1606273. DOI: 10.1002/adfm.201606273. 31. Köster, S.; Leach, J.; Struth, B.; Pfohl, T.; Wong, J.; Visualization of flow-aligned type I collagen self-assembly in tunable pH gradients. Langmuir. 2007, 23(2), 357-9. DOI: 10.1021/la062473a. 32. Lee, P.; Lin, R.; Moon, J.; Lee, L. Microfluidic alignment of collagen fibers for in vitro cell culture. Biomed. Microdevices. 2006, 8(1), 35-41. DOI: 10.1007/s10544-006-6380-z. 33. Lanfer, B.; Freudenberg, U.; Zimmermann, R.; Zimmerman, R.; Stamov, D.; Köster, V.; Werner, G. Aligned fibrillar collagen matrices obtained by shear flow deposition. Biomaterials. 2008, 29(28), 3888-95. DOI: 10.1016/j.biomaterials.2008.06.016. 34. Cudjoe, E.; Younesi, M.; Cudjoe, E.; Akkus, O.; Rowan, S. Synthesis and Fabrication of Nanocomposite Fibers of Collagen-Cellulose Nanocrystals by Coelectrocompaction. Biomacromolecules. 2017, 18(4):1259-67. DOI: 10.1021/acs.biomac.7b00005. 35. Zhuang, J.; Lin, J.; Li, J.; Weng, W.; Cheng, K.; Wang, H., Alternating potentials assisted electrochemical deposition of mineralized collagen coatings. Colloids Surf. B 2015, 136, 479-87. DOI: 10.1016/j.colsurfb.2015.09.050. 36. Chen, L.; Lin, J.; Li, J.; Wang, X.; Zhuang, J.; Wang, H.; Cheng, K.; Weng, W., Spatially-controlled distribution of HACC in mineralized collagen coatings for improving rhBMP-2 loading and release behavior. Colloids Surf. B 2016, 145, 114-21. DOI: 10.1016/j.colsurfb.2016.04.047. 37. Fusco, S.; Chatzipirpiridis, G.; Sivaraman, K. M.; Ergeneman, O.; Nelson, B. J.; Pane, S., Chitosan Electrodeposition for Microrobotic Drug Delivery. Adv. Healthcare Mater. 2013, 2 (7), 1037-1044. DOI: 10.1002/adhm.201200409. 38. Cheng, Z.; Cheng, K.; Weng, W. SiO2/TiO2 nanocomposite films on polystyrene for light-induced cell detachment application. ACS Appl. Mater. Interfaces.2016, 9(3), 2130-7. DOI: 10.1021/acsami.6b14182. 39. Yu, M. F., Gong, J. X., Zhou, Y., Dong, L. Q., Lin, Y. H., Ma, L., Weng, W. J., Cheng, K., Wang, H. M., Surface hydroxyl groups regulate the osteogenic differentiation of mesenchymal stem cells on titanium and tantalum metals. J. Mater. Chem. B 2017, 5, 3955-3963. DOI: 10.1039/C7TB00111H. 40. Matsugaki, A.; Aramoto, G.; Ninomiya, T.; Sawada, H.; Hata, S.; Nakano, T., Abnormal arrangement of a collagen/apatite extracellular matrix orthogonal to osteoblast alignment is constructed by a nanoscale periodic surface structure. 25



Page 26 of 26

Biomaterials 2015, 37, 134-143. DOI: 10.1016/j.biomaterials.2014.10.025. 41. Ling, T.; Lin, J.; Tu, J. J.; Liu, S. Q.; Weng, W. J.; Cheng, K.; Wang, H. M.; Du, P. Y.; Han, G. R., Mineralized collagen coatings formed by electrochemical deposition. J. Mater. Sci.: Mater. Med. 2013, 24 (12), 2709-2718. DOI: 10.1016/j.biomaterials.2014.10.025. 42. Felicia, L. J.; Philip, J., Effect of Hydrophilic Silica Nanoparticles on the Magnetorheological Properties of Ferrofluids: A Study Using Opto-magnetorheometer. Langmuir 2015, 31 (11), 3343-3353. DOI: 10.1021/acs.langmuir.5b00103. 43. Newman, P.; Nino, J. L. G.; Graney, P.; Razal, J. M.; Minett, A. I.; Ribas, J.; Ovalle-Robles, R.; Biro, M.; Zreiqat, H., Relationship between nanotopographical alignment and stem cell fate with live imaging and shape analysis. Sci. Rep. 2017, 7. DOI: 10.1038/srep37909. 44. Alapan, Y.; Younesi, M.; Akkus, O.; Gurkan, U. A., Anisotropically Stiff 3D Micropillar Niche Induces Extraordinary Cell Alignment and Elongation. Adv. Healthcare Mater. 2016, 5 (15), 1884-1892. DOI: 10.1002/adhm.201600096. 45. Yu, H. Y.; Tay, C. Y.; Pal, M.; Leong, W. S.; Li, H. Q.; Li, H.; Wen, F.; Leong, D. T.; Tan, L. P., A Bio-inspired Platform to Modulate Myogenic Differentiation of Human Mesenchymal Stem Cells Through Focal Adhesion Regulation. Adv. Healthcare Mater. 2013, 2 (3), 442-449. DOI: 10.1002/adhm.201200142.

Table of Content

26


Magnetically assisted electrodeposition of aligned collagen coatings

Recommend Documents