Multiwalled Carbon Nanotubes of Varying Size Lead to DNA

Jul 2, 2019 - Pro-inflammatory cytokines, including IL-1ß, IL-6, and TNF-α, were measured using enzyme-linked immunosorbant assay, while airway ...
0 downloads 0 Views 3MB Size
Download PDF
Article Cite This: Chem. Res. Toxicol. 2019, 32, 1545−1553

pubs.acs.org/crt

Multiwalled Carbon Nanotubes of Varying Size Lead to DNA Methylation Changes That Correspond to Lung Inflammation and Injury in a Mouse Model Elizabeth Cole, Jessica L. Ray, Shannon Bolten, Raymond F. Hamilton, Jr., Pamela K. Shaw, Britten Postma, Mary Buford, Andrij Holian, and Yoon Hee Cho*

Downloaded via TRINITY COLG DUBLIN on August 26, 2019 at 01:08:03 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

Center for Environmental Health Sciences, Department of Biomedical and Pharmaceutical Sciences, University of Montana, Missoula, Montana 59812, United States S Supporting Information *

ABSTRACT: Diversity in physicochemical properties of engineered multiwalled carbon nanotubes (MWCNTs) increases the complexity involved in interpreting toxicity studies of these materials. Studies indicate that epigenetic changes could be at least partially involved in MWCNTs-induced pro-inflammatory and fibrotic lung pathology. Therefore, we examined distinct methylation changes in response to MWCNTs of varied sizes to identify potential epigenetic biomarkers of MWCNTs exposure and disease progression. C57BL/6 mice were exposed via oropharyngeal instillation to a single dose (50 μg) to one of three differently sized MWCNTs: “narrow short” (NS), “wide short” (WS), and “narrow long” (NL). Vehicle-treated control mice received dispersion media (DM) only. Whole lung lavage fluid (LLF) and lung tissue were collected 24 h and 7 days postexposure to evaluate pro-inflammatory cytokines, epigenetic, or histological responses at acute and subchronic intervals, respectively. Luminometric methylation assay and pyrosequencing were used to measure global DNA methylation as well as promoter methylation of inflammation and fibrosis-related genes, respectively. Pro-inflammatory cytokines, including IL-1ß, IL6, and TNF-α, were measured using enzyme-linked immunosorbant assay, while airway thickening and interstitial collagen accumulation were measured in 7-day lung tissue using laser scanning cytometry. Distinct patterns of methylation (i.e., IL-1ß, IL-6, and TNF-α) among the different sized MWCNTs at 24 h postexposure corresponded to some pro-inflammatory cytokine measurements from whole LLF. Fibrosis-related gene, Thy-1, was significantly hypermethylated after exposures to WS and NL MWCNTs, while only NL MWCNTs induced significantly lower global DNA methylation. After 7 days, a hierarchy in airway thickness and interstitial collagen deposition was observed: NS < WS < NL. However, only airway thickness was significantly greater in the WS and NL MWCNTs-exposed groups than the DM-exposed group. These data suggest that methylation changes could be involved in the initial immune response of inflammation and tissue remodeling that precedes lung disease in response to different MWCNTs sizes.

■

respiratory tract.2 The increasing incorporation of these materials into consumer products raises the concern that adverse human health effects will emerge due to environmental exposures.3 ENM bioactivity and the potential to cause an inflammatory response associated with a pathological event have been

INTRODUCTION

Over the past 20 years, utilization of engineered nanomaterials (ENM) in a wide variety of medical, engineering, and personal products has proven to be exceedingly advantageous.1 Multiwalled carbon nanotubes (MWCNTs) are one of the most widely produced ENM and are increasingly used in consumer applications for technological advantages. However, in animal models, respiratory exposure to MWCNTs has been shown to cause significant pathological changes in the © 2019 American Chemical Society

Received: February 22, 2019 Published: July 2, 2019 1545

DOI: 10.1021/acs.chemrestox.9b00075 Chem. Res. Toxicol. 2019, 32, 1545−1553

Article

Chemical Research in Toxicology

MWCNTs were suspended in a 25 μL solution per mouse (2 mg/kg or 50 μg/25 g mouse). MWNCTs Exposure and Tissue Collection. Mice were exposed to MWCNTs by oropharyngeal aspiration. Three different MWCNTs suspensions (25 μL, NS, WS, and NL) were delivered into the back of the throat of anesthetized mice, with the tongue held to one side to allow the solution to be aspirated into the lungs. Control group mice received DM suspension only. After 24 h or 7 days, mice were euthanized by sodium pentobarbital (Euthasol, Shering-Plough, Kenilworth, NJ), and LLF and lung tissues were harvested for proinflammatory cytokines, epigenetic, or histological analyses. Pro-inflammmatory Cytokines Measurment. Bronchoalveolar lavage was performed to collect whole LLF from mice, 24 h and 7 days postexposure using 1 mL of ice-cold PBS (pH 7.4). Enzymelinked immunosorbant assay (ELISA) was conducted to measure cytokine levels in LLF. IL-1ß, IL-6, and TNF-α were measured using corresponding Duoset ELISA kits (R&D Systems, Minneapolis, MN) according to the manufacturer protocols. ELISA plates were read at 450 nm and amounts expressed as pg/mL. Histology. Histological preparations have been previously described.12 Briefly, lungs were inflation-fixed through the trachea with 3% paraformaldehyde-PBS and submerged in the same fixative at 4 °C overnight. Lungs were then washed with cold PBS, dehydrated, and embedded in paraffin using a Leica ASP 300 tissue processor (Buffalo Grove, IL). A Leica RM2235 microtome (Buffalo Grove, IL) was used to prepare tissue sections of 5−6 μm that were trichrome stained with hematoxylin and eosin (HE) using Weigert’s hematoxylin (Electron Microscopy Services, Hatfield, PA) and Gomori trichrome (Harleco, EMD, VWR Randor, PA) using a Shandon 24−4 autostainer (GMI, Ramsey, MN) and then deparaffinized and ultimately mounted on glass slides and coverslipped. Collagen Deposition and Airway Thickness. Fibrotic responses to MWNCTs exposure within lungs were measured and imaged with a Thor Laboratories (formerly CompuCyte) iCys Laser Scanning Cytometer (Sterling, VA) using a previously described protocol designed to quantitatively assess collagen deposition in response to respiratory insult in a mouse model.12,13 Briefly, a lowresolution scan of the entire tissue at 20× was first conducted for each tissue section. Using the incorporated iCys Workstation computer software tools (version 3.4, Sterling, VA), six interstitial areas and six airways for high-resolution scans were hand selected by the operator, at random, blinded to the particular conditions of each section (DM, NS, WS, or NL exposed). “Phantom” contours were used to divide tissues into very small (8 mm diameter) circles, with a blue staining contour considered as a collagen-positive event. Positive contour percentages over total tissue contours were calculated to compare one tissue to another. All airways and blood vessels were removed from the calculation of total collagen deposition, and open airways or torn or folded tissue sections were excluded from the analysis. Two sections per one lung lobe 21−28 μm apart were analyzed and averaged. Genomic DNA Preparation. Genomic DNA was extracted from lung tissues according to the manufacturer’s protocols using the DNeasy Blood and Tissue Kit (Qiagen, Valencia, CA). Global DNA Methylation by Luminometric Methylation Assay (LUMA). DNA global methylation was measured via LUMA as previously described.14−16 In brief, a 500 ng total genomic DNA sample was cleaved by the methylation sensitive restriction enzyme (HpaII) and its methylation insensitive isoschizomer (MspI) in parallel reactions. The extent of cleavage within the digested samples was quantified by bioluminometric polymerase extension using pyrosequencing on a PyroMark Q96 MD (Qiagen). HpaII/MspI ratio was used to calculate percentage of 5-methylcytosine (5-mC). Samples were run in duplicates on plates with positive, negative, and water controls. Primer Design. Methylation levels in the promoter regions of selected genes (IL-1β, IL-6, TNF-α, and Thy-1) were measured using pyrosequencing assay. Gene-specific primers for these genes were designed using the PyroMark assay design software (version 2.0, QIAGEN) as described previously.13 The program automatically

attributed to individual chemical and physical characteristics such as length, diameter, presence of contaminants, and rigidity.4 We previously published that variations in MWCNTs diameter and length (“narrow short” (NS), “wide short” (WS), and “narrow long” (NL)) were major determinants of inflammatory potential and MWCNTs-induced lung disease development.5 Comprehensive studies of MWCNTs toxicity remain challenging due to the high variability in bioactivity, which increases the challenges for mechanistic and predictive studies necessary to understand the factors contributing to MWCNTs-induced lung pathology. Epigenetic alterations are associated with the development and progression of numerous pathological states and diseases.6 Thus, there is a great deal of potential for the use of epigenetic biomarkers to better identify the early stage response and molecular mechanisms by which environmental exposures to MWCNTs lead to inflammation and lung disease. While mechanisms of MWCNTs-associated disease processes remain to be clearly defined, evidence continues to grow, and several recent studies show that MWCNTs exposure may trigger epigenetic alterations in the target tissues and cells when the inflammatory response is initiated.7 DNA methylation is an extensively studied form of epigenetics that is responsible for proper gene expression in a tissue- and cell-specific manner.8 It has been consistently shown that MWCNTs trigger global and gene specific DNA methylation changes.7,9−11 In this study, we expand on previously published work from our group to evaluate epigenetic alterations associated with exposure to MWCNTs of different sizes (NS, WS, and NL) and their relationships to increased inflammation and lung disease.5 On the basis of previous results, we hypothesized that MWCNTs size (length and diameter) correlates to biological activity via epigenetic changes. Thus, global DNA methylation and inflammatory (i.e., IL-1ß, IL-6, and TNF-α) and fibroticspecific gene (Thy-1) methylation were measured in lung tissue after a single exposure to different sized MWCNTs in a mouse model, with measurement of corresponding cytokines IL-1ß, IL-6, and TNF-α in lung lavage fluid (LLF) 24 h and 7 days postexposure. Airway thickness and interstitial collagen deposition, markers of lung fibrosis, were also measured 7 days postexposure.

■

MATERIALS AND METHODS

Animals. Both male and female two-month old C57BL/6 mice were maintained in specific pathogen-free conditions (22 ± 2 °C, 30− 40% humidity, 12 h light/12 h dark cycles) and offered food and water ad libitum in the animal facility of the University of Montana (UM, Missoula, MT). All experiments met the approval of the University of Montana Institutional Animal Care and Use Committee (IACUC). MWCNTs Preparation. Three different sized original, “asreceived” MWCNTs (Cheaptubes Inc., Cambridgeport, VT) narrow diameter and short length (10−20 nm, 0.5−2 μm), “NS”; wide diameter and short length (30−50 nm, 0.5−2 μm), “WS”; and narrow diameter and long length (10−20 nm, 10−30 μm), “NL”, were used as described previously,5 and their characterizations of size parameters as well as chemical compositions were summarized in Table S1. In brief, within an enclosed scale, MWCNTs were weighed and suspended in dispersion medium (DM, PBS containing 0.6 mg/mL mouse serum albumin (Sigma-Aldrich, St. Louis, MO) and 0.01 mg/ mL 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (Sigma-Aldrich)). MWCNTs stock suspensions (2 mg/mL) were sonicated for 2 min at half max power in a Masonix cup-horn sonicator (XL2020, Farmingdale, NY) attached to a Forma circulating water-bath at 550 W and 20 Hz (8000 Joules) at a stock concentration of 5 mg/mL. 1546

DOI: 10.1021/acs.chemrestox.9b00075 Chem. Res. Toxicol. 2019, 32, 1545−1553

Chemical Research in Toxicology

■

generates primer sets that include both PCR and sequencing primers based on selected target sequences. Primers were designed for analyzing 2−3 CpGs within the promoter regions. Figure 1 and Table 1 show the detail of the primers and PCR conditions used in this study.

Article

RESULTS

We previously showed that different sized MWNCTs induced the production of distinct cytokine profiles (i.e., IL-1ß, IL-6, and TNF-α) as well as lung pathology scores in the order of DM < NS < WS < NL, which suggested that wider and longer sized MWCNTs induce a greater inflammatory response and subsequent lung disease.5 In the present study, we further examined airway thickness and interstitial collagen deposition in lung tissues 7 days postexposure to NS, WS, and NL MWCNTs, respectively. Since earlier work measured ex vivo cytokine release (from cells that were collected from lung lavage of mice 24 h after MWCNTs exposures), in this study, we measured the cytokine levels directly from the LLF, to permit more direct correlation of cytokine levels to DNA methylation patterns from whole lung tissue, having a heterogeneous cell population. Furthermore, to better understand the role of DNA methylation in response to differently sized MWCNTs, we measured global DNA methylation (as an overall indicator of epigenetic response to disease)17 and the methylation levels of gene-specific promoter regions. All genes were chosen based on previous identification as potential epigenetic regulators of inhalation-related inflammatory and fibrotic responses.13,18 Whole Lung Lavage Pro-inflammatory Cytokine Production in Response to MWCNTs. Pro-inflammatory cytokines such as IL-1ß, IL-6, and TNF-α were measured 24 h and 7 days postexposure to different sized MWCNTs. The levels of IL-1ß 24 h postexposure to different sized MWCNTs were observed within the order of DM < NS < WS < NL (Figure 2A); however, only WS MWCNTs-exposed group showed a borderline significance compared to the DM-exposed group (p = 0.053). At 7 days postexposure, all MWCNTsexposed groups showed lower levels of IL-1ß, but only NS MWCNTs exposure showed a borderline significance compared to DM exposure (p = 0.057). NS, WS, and NL MWCNTs exposures increased IL-6 levels compared to DM exposure; however, there were no statistically significant relationships detected at 24 h postexposure. At 7 days postexposure, the levels of IL-6 in all different sized MWCNT-exposed groups were decreased significantly compared to DM-exposed group (p = 0.013 for NS, p = 0.017 for WS, and p = 0.029 for NL) (Figure 2B). There were statistically significant differences of TNF-α between DM-exposed mice and WS (p = 0.002) or NL MWCNTs-exposed groups (p = 0.011) 24 h postexposure,

Figure 1. Position of target genes and CpG sites in their promoter that were analyzed in the study. Gene-Specific Methylation by Pyrosequencing Assay. Genomic DNA first underwent bisulfite modification to convert unmethylated cytosine residues to uracil using the EZ DNA Methylation Kit (Zymo Research, Orange, CA) following the protocol from the manufacturer. The pyrosequencing assay was performed to measure promoter methylation of selected genes as previously described.12,13 Briefly, 50 ng samples of bisulfite-treated DNA were PCR amplified using PyroMark PCR kits (Qiagen). A PyroMark Q96 Vacuum Workstation with Streptavidin Sepharose High Performance Beads (GE Healthcare, Piscataway, NJ) was used for sample immobilization, and a PyroMark Q96 MD was used for all subsequent pyrosequencing (Qiagen). Samples were processed in duplicates on plates with water controls. Percent methylation of a sample was calculated by averaging all of the interrogated CpG sites. Statistical Analyses. Statistical analyses were performed using Graphpad Prism 7 (Graphpad Software, San Diego, CA). In cases where multiple variables were simultaneously compared, statistical significance was tested using one-way ANOVA, followed by Tukey’s multiple comparisons post hoc analysis. Nonparametric two-tailed Mann−Whitney testing was used in certain cases of two comparisons. All statistical significance was defined as the probability of type I error occurring at less than 5% (p < 0.05).

Table 1. Primer Sequences and PCR Conditions Used for Gene-Specific Methylation Analysis target (gene ID)

primer

sequence (5′−3′)

annealing temp (°C)

PCR product (bp)

Thy-1 (21838)

forward: reverse: sequencing: forward: reverse: sequencing: forward: reverse: sequencing: forward: reverse: sequencing:

AAAGAAAGGGTTATAATTTTAAAAGGAGAGa ACTACTAAAAAAACACTCTCAATCCTATA ACACTCTCAATCCTATAAT AAGTTTTTAGAGGGTTGAATGAGAGTTTa TCCCTCCTAACTAATCCCTTACTATC ACTAATCCCTTACTATCCT TTGTATAATTGTTTAGGGGGAAATAATG ACTACCCTAAAATAATTTCTAATCCCa AGGGGGAAATAATGTT AATGGTGTGAAGTAAAAGTGTTTTTAGA AAAATTTCCTTTCCACTCCTTAAACTCTCa ATGGTATAGGTGGGTA

52.2

154

52.0

128

50.0

116

53.4

108

TNF-α (21926)

IL-1β (16176)

IL-6 (16193)

a

Biotin labeled primer. 1547

DOI: 10.1021/acs.chemrestox.9b00075 Chem. Res. Toxicol. 2019, 32, 1545−1553

Article

Chemical Research in Toxicology

Figure 2. Release of inflammatory cytokines in response to MWCNTs from whole lung lavage 24 h and 7 days postexposure. Alterations in levels of (A) IL-1β, (B) IL-6, and (C) TNF-α. Data expressed as mean ± SEM. Asterisks indicate significance at ∗ p < 0.05, ∗∗ p < 0.01, and # borderline significance (p < 0.1). N = 3−4 for each group.

while there was a borderline significance between DM and NS (p = 0.060) (Figure 2C). At 7 days postexposure, the TNF-α level in DM-exposed group was significantly greater than those in NS (p = 0.003) and NL MWCNTs-exposed groups (p = 0.035). Different Sized MWCNTs Cause Airway Thickness and Collagen Deposition. Figures 3 and 4 show representative

Figure 4. Interstitial collagen deposition in mice exposed to different sized MWCNTs for 7 days. Interstitium exposed to (A) DM control, (B) NS MWCNTs, (C) WS MWCNTs, and (D) NL MWCNTs from trichrome stained lung tissue sections. Collagen is stained in light blue. The representative images for each group are six scanned fields (250 μm × 188.2 μm) stitched together using 400× magnification. Quantification of collagen was performed via software tools. (E) Alterations in levels of percent collagen deposition after 7 days of MWCNTs exposures are shown. Data are expressed as mean ± SD N = 4 for each group.

Figure 3. Airway thickness in mice exposed to different sized MWCNTs for 7 days. Airways of lung exposed to (A) DM control, (B) NS MWCNTs, (C) WS MWCNTs, and (D) NL MWCNTs from trichrome stained lung tissue sections. The representative images for each group are six scanned files (250 μm × 188.2 μm) stitched together using 400× magnification. Software tools were used to measure airway thickness in microns. (E) Alterations in levels of percent airway thickness after 7 days of MWCNTs exposures are shown. Data are expressed as mean ± SD. Asterisks indicate significance at ∗∗ p < 0.01 and # borderline significant (p < 0.1). N = 5 for each group.

NL) corresponds to the pattern in previously observed lung pathology scoring, where a five-point scale was used to discriminate observations in severity and extent of inflammation, cellularity, and fibrotic lesions.5 Histology data also correlate with in vitro and ex vivo alveolar macrophage cytokine production,5 demonstrating that gross lung pathology and airway thickening correspond to inflammatory cytokine levels. Interstitial collagen deposition after exposure to different sized MWCNTs was increased in the same pattern as airway thickness; however, these levels were not statistically significant (Figure 4E). Different Sized MWCNTs Induced Global DNA Hypomethylation. In this study, we measured global methylation changes from lung tissue of mice using LUMA to obtain an overall context of the influence of MWCNTs size on DNA methylation in respiratory disease. As shown in Figure 5, a trend of decreasing global methylation was observed at both 24 h and 7 days, which corresponded to the previously established hierarchy of MWCNTs toxicity (DM < WS < NS < NL).5 After 24 h, the NL MWCNTs-exposed group was significantly hypomethylated more than the DM-exposed group (NL, 64.61% vs DM, 69.83% p = 0.002). Furthermore, NL was significantly hypomethylated more than NS (NS: 69.46%, NS vs NL p = 0.011) and WS (WS: 67.83%, WS vs NL p = 0.034). WS MWCNTs also induced more hypomethylation than did the DM control; however, this

airway thickness and interstitial collagen deposition in lung tissue sections taken from C57BL/6 mice 7 days postexposure. The morphological characteristics of the control group were consistent with those expected of healthy lung tissue (Figures 3A and 4A). In contrast, exposure to different sized MWCNTs increased airway inflammation, airway thickness, and deposition of collagen in the lungs, as indicated by the punctate light blue areas due to trichrome stain (Figures 3B−D and 4B−D). Quantitative assessments of airway thickness and interstitial collagen deposition were also conducted. For quality control purposes, airways of similar size (determined by measuring airway area) were used to measure airway thickness. Seven days postexposure, WS and NL MWCNTs-exposed mice exhibited significantly more airway thicknesses (Figure 3E) than did DM-exposed mice, which provided evidence of increased inflammation and airway remodeling following WS and NL MWCNTs exposure in mice. Furthermore, the pattern observed in increasing airway thickness (DM ≪ NS ≪ WS < 1548

DOI: 10.1021/acs.chemrestox.9b00075 Chem. Res. Toxicol. 2019, 32, 1545−1553

Article

Chemical Research in Toxicology

only be involved in an acute inflammatory response to WS and NL MWCNTs. The promoter methylation of another pro-inflammatory cytokine, IL-6, displayed similar trends 24 h after exposure: NL MWCNTs was significantly hypomethylated (DM, 21.35% vs NL, 18.83%) (Figure 6B), corresponding to previous observations of significantly elevated IL-6 cytokine release 24 h after exposure to NL.5 After 7 days, no significant methylation pattern emerged, which collectively suggested a possible role of IL-6 promoter methylation response in the immediate inflammatory response to NL MWCNTs only. TNF-α promoter methylation levels appeared to be maintained from acute to subacute exposure responses, with overall similar methylation patterns observed at 24 h and 7 days postexposure (Figure 6C). At 24 h postexposure, the promoter regions of TNF-α in NS (6.32%), WS (5.01%), and NL MWCNTs (5.99%)-exposed mice were significantly hypomethylated compared to DM control mice (8.54%). This decrease in TNF-α methylation corresponded to the previously observed increase in TNF-α production in the lungs of NL MWCNTs-exposed mice 24 h postexposure.5 After 7 days, while the same hierarchial methylation trend was observed, this pattern was nonsignificant, with only WS showing a borderline significance. Under nonfibrotic lung conditions, Thy-1 protein suppresses the differentiation of myofibroblasts, the primary cell type involved in collagen production.19 However, in the fibrotic disease state, Thy-1 expression is diminished, and the gene has been observed to be hypermethylated in CpG sites within its promoter.20,21 Correspondingly, the selected promoter region of Thy-1 was hypermethylated in NL and WS MWCNTsexposed mice both 24 h and 7 days after exposure. Compared to DM controls (5.29%), WS (6.65%) and NL MWCNTs (6.68%) were significantly hypermethylated after 24 h, while only NL MWCNTs were significantly hypermethylated after 7 days (Figure 6D). Taken together with the increased airway thickness in WS and NL MWCNTs at 7 days postexposure, Thy-1 hypermethylation corresponds to fibrotic lung disease

Figure 5. Global DNA methylation after different sized MWCNTs exposure. Changes in percent methylation 24 h and 7 days after exposures to NS, WS, and NL MWCNTs using LUMA are shown. Data are expressed as mean ± SD percent methylation. Asterisks indicate significance at ∗ p < 0.05 and # borderline significant (p < 0.1). N = 5−8 for each group.

result was borderline significant. While the overall methylation trends observed at 24 h seem to persist as observed in the 7 days postexposure groups, no statistically significant differences between WS and NL MWCNTs were observed. Different Sized MWCNTs Induced Methylation Changes in Selected Genes. Significant changes in gene promoter methylation corresponding to measurements of inflammatory cytokines production, airway thickness, and interstitial collagen accumulation (i.e., fibrosis) were detected in lung DNA from mice 24 h and 7 days after exposure to different sized MWCNTs. For IL-1ß, after 24 h, an overall decrease in methylation was observed comparing across DM, NS, WS, and NL MWCNTsexposed mice. Compared to the methylation levels of the control group (80.49%), the groups exposed to WS (79.56%) and NL MWCNTs (79.27%) were both significantly hypomethylated (Figure 6A). Hypomethylation is suggestive of increased gene expression and correlates to the elevated levels of IL-1β observed previously. After 7 days, the trend reversed, showing increased methylation (DM < NS < WS < NL). These data suggest a potential regulatory response developing at 7 days, or that IL-1ß promoter methylation may

Figure 6. Promoter methylation status in lung tissue of different sized MWCNTs-exposed mice. Change in percent methylation 24 h and 7 days after exposures to NS, WS, and NL MWCNTs for inflammation- and fibrosis-related genes is shown; (A) IL-1β, (B) IL-6, (C) TNF-α, and (D) Thy-1. Data are expressed as mean ± SD percent methylation. Asterisks indicate significance at ∗ p < 0.05, ∗∗ p < 0.01, and # borderline significant (p < 0.1). N = 4−8 for each group. 1549

DOI: 10.1021/acs.chemrestox.9b00075 Chem. Res. Toxicol. 2019, 32, 1545−1553

Article

Chemical Research in Toxicology

reported in vivo lavage measurements from MWCNTs-exposed mice. At 7 days postexposure, no significant methylation comparisons were observed, and IL-1ß cytokine measurement revealed only NS MWCNTs-exposed cytokine levels from whole tissue lavage fluid were borderline significantly less than DM. While IL-1ß cytokine production has been implicated in chronic inflammation,25 the results suggest that IL-1ß hypomethylation may be involved in acute IL-1ß inflammatory response to certain MWCNTs, with dynamic epigenetic remodeling occurring during short-term inflammation that diminishes coinciding with the decreased cytokine levels as observed at 7-days postexposure. Similar observations in MWCNTs trends were made for prior IL-6 cytokine data5 and this study’s IL-6 promoter methylation results at 24 h postexposure. IL-6 cytokine measurement in vivo neither revealed any significant differences in MWCNTs exposed mice, nor any direct concordance with the acute, 24-h postexposure methylation patterns, despite the agreement of these epigenetic data with prior ex vivo cytokine data. This difference may not be surprising, due to the heterogeneous cell populations measured from lung lavage, as opposed to measurement from refined, cultured cell populations and furthermore, statistical under-powering in the cytokine profiling (N = 3−4 per group). IL-6 is part of the Th17 cytokine family, a driver of pro-inflammatory responses, where hypomethylation of its gene promoter corresponds to expression.26,27 Th17 cytokines such as IL-6 have been associated with an acute immune response preceding fibroblast activity and other tissue remodeling in epithelial and endothelial cells.28 This acute role of IL-6 in the proinflammatory context is evident in the comparative reduction of cytokines in the MWCNTs-exposure groups only, after 7 days, compared to 24 h postexposure. Previously, we showed that MWCNTs exposure leads to IL-6 promoter hypomethylation with increased protein levels after 24 h and subsequently increases in airway thickness after 7 days.18 The methylation results of this study, in conjunction with our 7 day postexposure airway thickening data and our previous cytokine profiling, indicate acute IL-6 cytokine production might be epigenetically driven and possibly involved in the early stages of lung fibrosis and airway inflammation in response to MWCNTs of varying sizes. TNF-α is a pro-inflammatory cytokine responsive to particle exposure and has been suggested to be influential in inflammation-driven fibrosis.29 We previously demonstrated that MWCNTs exposure leads to TNF-α promoter hypomethylation in lung tissue at 24 h and 7 day postexposure intervals, corresponding to both increased protein levels in lung lavage after 24 h and increased interstitial collagen accumulation in lung tissue after 7 days.13 In this study, we analyzed TNF-α promoter CpG sites downstream to the promoter region previously reported;13 although the observed methylation percentages were overall lower, there was a trend of increasing hypomethylation in lung DNA from MWCNTsexposed mice corresponding to observed bioactivity both in cytokine measurement from this study and in the prior observation’s 24 h TNF-α cytokine production.5 Further, this trend continued when considering airway thickening observed in this study 7 days after exposure. While the 7 day postexposure methylation patterns appeared to resemble epigenetic stability, the in vivo cytokine levels, however, shifted in comparison to 24-h cytokine levels and could be supportive of the major acute response role of TNF-α cytokines preceding

outcomes following MWCNTs exposure. These data suggest that Thy-1 methylation is a good candidate as a biomarker for adverse outcomes following MWCNTs inhalation. In addition, the trend of cytokine levels including IL-1ß, IL6, and TNF-α across DM and different sized MWCNTsexposures corresponded to the methylation pattern at 24 h postexposure. After 7 days, the cytokine levels no longer directly corresponded to the methylation patterns from the same time point, which indicated possible alternative mechanistic influence in cytokine production at that time point, and a diminished potential role of promoter methylation. Overall, cytokine levels fluctuated between the two postexposure time points in only the mice that were exposed to different sized MWCNTs of 24 h and 7-day postexposure groups; the control group cytokine levels from mice in both time points appeared stable, which can indicate the shift from pro-inflammatory to tissue remodeling and possibly fibrosis conditions within lung tissue in response to the different sized MWCNTs.

■

DISCUSSION In a previous study by our group, both in vitro toxicity and in vivo biological activity corresponded with exposure to thicker and longer MWCNTs.5 To our knowledge, no studies have yet attempted to correspond MWCNTs size-dependent lung pathology and pro-inflammatory cytokine levels to mechanistically relevant changes in global and gene-specific methylation in vivo. We previously reported that a single oropharyngeal exposure to MWCNTs contaminated with a relatively high concentration of nickel (FA-21) induced global DNA hypomethylation in lung tissue of C57BL/6 mice and methylation changes in several key genes (i.e., IL-6, IL-5, TNF-α, CXCL-1, IFN-γ, and Thy-1), which corresponded to gene expression changes in pro-inflammatory cytokine and fibrotic response pathways.13,18 Thus, we measured methylation changes (both global DNA methylation and gene-specific methylation) to better determine the potential utility of these changes as a lung disease biomarker and to strengthen mechanistic understanding of how MWCNTs of varying sizes (length and diameter) elicit differing degrees of lung inflammation and injury (i.e., lung tissue remodeling) in vivo. Assessment of global hypomethylation provided the basis for information for biomarkers of inflammation and fibrosis-driven lung disease. Given functional roles of genes in particleinduced pro-inflammatory and fibrotic responses in lung tissue,22 IL-1ß, IL-6, TNF-α, and Thy-1 were selected for the gene-specific methylation analysis in this study. IL-1ß is a critical mediator of local and systemic inflammation following NLRP3 inflammasome activation in response to MWCNTs-induced lysosomal membrane permeability.23 It is well-established that promoter methylation status influences disease-related gene expression of IL-1ß.24 At 24 h postexposure to WS and NL MWCNTs, significant IL-1ß hypomethylation was observed. This methylation pattern corresponded to the expected, but nonsignificant, cytokine trend measured from in vivo LLF after 24 h. Furthermore, these results were in agreement with ex vivo IL-1ß measurement in which WS and NL MWCNTs-exposed cells displayed significant IL-1ß cytokine elevation, as reported previously. It should be noted that the nature of ex vivo cytokine profiling permits discovery of more pronounced cytokine levels in comparison to whole tissue in vivo inquiry; the lower IL-1ß in vivo levels measured in this study were similar to our previously 1550

DOI: 10.1021/acs.chemrestox.9b00075 Chem. Res. Toxicol. 2019, 32, 1545−1553

Article

Chemical Research in Toxicology fibrosis. These results suggest that TNF-α promoter hypomethylation could have an influence in acute-phase inflammatory responses and that MWCNTs size influences the extent of promoter methylation preceding onset of airway injury. The pro-inflammatory genes examined in this study were hypomethylated in lung tissue exposed to the largest MWCNTs after 24 h, which corresponded to the previously reported 24 h respective cytokine levels. However, no overall 7-day postexposure methylation trends were observed in these genes despite evidence of prolonged inflammation yielding significant airway thickening in WS- and NL-exposed mice 7 days later. Prior work has shown significant retention of WS and NL MWCNTs in lung tissue 7 days postexposure, which fits within the paradigm of DM < NS < WS < NL bioactivity.5 Collectively, this information indicates that promoter methylation of the genes examined could have a dynamic involvement in the immediate immune response to MWCNTs with increasing size (WS and NL), with any mechanistic role potentially diminishing sometime after 24 h, leading up to 7 days postexposure. Hypermethylation of Thy-1 promoter has demonstrated involvement in lung disease and down-regulation of this gene and has been associated with interstitial pulmonary fibrosis in patients.19−21 We previously showed that Thy-1 hypermethylation corresponds to increased mRNA expression and MWCNTs-induced collagen burden in lung tissue.13 Not surprisingly in this study, WL and NL MWCNTs exposure led to the greatest hypermethylation after 24 h, with a persistent size-dependent methlyation trend as evidenced by the 7 day postexposure data for NL MWCNTs exposure. Thy-1 promoter methylation appears to be influenced by MWCNTs of varying sizes, in support of the overall hypothesis that MWCNTs size is an important determinant of bioactivity observed within the lungs of mice. Furthermore, significant global hypomethylation at different time points (24 h and 7days) was observed in this study. These results agree with previous work from our laboratory and elsewhere that reported global hypomethylation in response to particle exposure.13,30,31 There remains a critical need to understand whether epigenetic alterations, in response to environmental exposures can affect gene expression and whether these changes in DNA methylation could alter the lung environment over the long-term.32 These findings contribute to our understanding of whether MWCNTs-sizedependent exposures can induce lasting alterations that may contribute to disease development, including fibrosis, long after the initial response. Pulmonary fibrosis has a complex etiology, and the current understanding suggests that the disease is heterogeneous in immunological markers and progression from chronic inflammation to fibrogenesis.33 It would not be unreasonable then to expect that the elevated pro-inflammatory and profibrotic indicators observed here and in previous studies could be predictive of fibrosis-type lung disease. The methylation trends found in this study revealed significant differences that were detected within 24 h postexposure, particularly for WS and NL MWCNTs-exposed lung tissue DNA. These results could be interpreted as indicating immediate, possibly mechanistic epigenetic alterations in response to the most bioactive MWCNTs studied here (WS and NL), possibly involved in acute cytokine production. However, these results could hint at current limitations of epigenetic studies, particularly for DNA methylation analysis.

In response to particle exposure in the lungs, the immune system immediately initiates acute inflammation that can either resolve or continue toward chronic inflammation associated with lung disease34 After an immediate neutrophil surge, a variety of lung cell types are activated under inflammation, including lymphocytes and macrophages. The cellular population dynamically changes toward either resolution, with effective apoptotic clearance and repopulation of healthy tissue, or dysregulation tending toward chronic inflammation that could precede fibrogenic lung disease.34 Future work could profile methylation status at later postexposure time points to determine if significant epigenetic profiles correspond to more defined or progressed pulmonary fibrosis in vivo. In this study, we captured snapshots of CpG methylation levels of certain areas within select gene promoters; however, these results cannot fully account for all the dynamic methylation changes responsive to MWCNTs exposures. Moreover, given that acute inflammation alone involves dynamic population and repopulation of various cell types, if DNA methylation is mechanistically involved, dynamic methylation and demethylation would be occurring for recruitment of various cell types within the lung. Cell-specific DNA methylation analysis, if the limitations in DNA quantity using bisulfite-pyrosequencing could be overcome, could provide a clearer explanation of significant epigenetic occurrences at a cellular level, particularly in the time frame from 24 h postexposure leading up to 7 days postexposure.35 In vivo measurement of specific contributions of key DNA methylating enzymes (i.e., DNA methyltransferases), could be an informative future direction with these advances in the field of epigenetic research. Furthermore, discriminating between active methylation and demethylation products would permit a better understanding of the possible roles of gene promoter methylation in response to MWCNTsinduced bioactivity in vivo.9,36 Nevertheless, the results from this study provide important information to understand the influence of MWCNTs size on DNA methylation changes preceding lung injury. Whole tissue epigenetic analyses continues to provide an immediate, directional framework to inform future investigations as technology permits more detailed epigenetic investigation. Previously, we determined that increased width or length corresponds to more severe lung pathology and greater retention/less clearance of MWCNTs from lung tissue.5 We extended this understanding of the importance of MWCNTs exposure length and width on bioactivity by positively corresponding it to airway thickening. While our laboratory has previously investigated epigenetic changes occurring in response to MWNCTs exposures in a mouse model, this was the first study to demonstrate methylation changes in response to different sized MWCNTs and their relationship with corresponding inflammatory and fibrotic responses. Our results are concordant with the main hypothesis of these studies; there is a hierarchical bioactivity corresponding to length and width of MWCNTs of otherwise similar chemical composition. As stated above, we previously measured methylation changes in response to FA-21 exposure.13,18 Comparatively, the MWCNTs in this study contained only trace levels of metal contaminants and were of similar elemental composition, differing primarily in length and width.5 These elemental differences in MWCNTs could account for any slight deviation in global and gene-specific methylation values reported in this study compared to our previous data, where mice were exposed to the same doses and postexposure intervals. We also 1551

DOI: 10.1021/acs.chemrestox.9b00075 Chem. Res. Toxicol. 2019, 32, 1545−1553

Chemical Research in Toxicology

Article

■

CONCLUSION Overall, in this study, we have shown that methylation data (both global DNA methylation and promoter methylation in the selected genes) had some correspondence to lung inflammatory and fibrotic responses; the most bioactive MWCNTs (WS and NL) induced the most severe acute inflammatory response with indicators of fibrosis disease (airway thickness) over time. Given that NL MWCNTs, followed by WS, have the greatest size of the three MWCNTs in this study, size could be an important factor of bioactivity including for epigenetic changes that could influence disease progression in vivo.

attempted to measure interstitial collagen accumulation using laser scanning cytometry; however, no significant differences in collagen accumulation were observed. One limitation of this method, beyond small sample size in this study, is that only a relatively small area of the lung is sampled. This method might not fully account for the tendency of MWCNTs to agglomerate and potentially deposit in certain areas where inflammation and fibrosis could localize and remain unaccounted for, particularly in the subchronic postexposure interval of 7 days. Tissue collagen can be directly measured using the hydroxyproline assay, however, this method is limited in its capacity to detect the more subtle abnormal collagen accumulation that is characteristic of MWCNTs subchronic postexposure intervals. This trend has been evident in this study and in previous laser scanning cytometry measurements. Using the hydroxyproline assay, we have measured responses to the same dose of FA-21 MWCNTs (which is known to trigger a pro-inflammatory and fibrotic response) after 7 days, however, no significant differences were found between control and exposed lungs (data not shown), despite significant differences reported in interstitial percent collagen as measured by laser scanner cytometry.13 As our group has already determined, WS and NL are retained in lung tissue at 7 days postexposure;5 therefore, it is possible more distinct fibrosis may appear at a later time, since clearance was an issue for the larger sized MWCNTs. Collectively, these findings point to the challenges and limitations of quantifying and describing fibrosis indicators relevant to MWCNTs-induced lung disease. Profiling disease progression over a longer term interval could provide insight into the progression of MWCNTsinduced lung disease and potential epigenetic influence. In this study there was no clear observation of patterns of persistence in methylation collectively in pro-inflammatory genes from 24 h to 7 days postexposure. The full meaning of this observation is not yet certain; methylation is considered a dynamic genomic event, and it remains to be answered whether further examination at a later postexposure interval or a more frequent measurement of epigenetic changes between 24 h and 7 days could reveal potentially important mechanistic insight. Furthermore, promoter methylation associated with immune responses to MWCNTs could be resolving at 7 days; however, it is possible that the heterogeneity of cells within whole lung tissue could be masking distinct methylation of specific cell populations at that time point. In addition, in this study, we measured in vivo pro-inflammatory cytokine responses at two postexposure intervals, with airway inflammation and collagen accumulation quantified at a subchronic exposure interval. These findings, in conjunction with the previously reported results, demonstrates a possibility for a relationship between size-influenced MWCNTs exposure methylation changes and the phenotype changes associated with respiratory disease, but should not at this time be overinterpreted as demonstrating a causal or definite mechanistic relationship. To a degree, this limitation still applies to the field of epigenetics in terms of correlational observations in vivo. However, since significant differences in promoter methylation of key pro-inflammatory and fibrosis-related genes were found in response to these MWCNTs, that were correlated to in vivo observations in cytokine production and airway thickening, these findings are informative, particularly for MWCNTs-exposure epigenetic biomarker utility, of which there continues to be very limited information.

■

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.chemrestox.9b00075. Physico-chemical properties of MWCNTs (PDF)

■

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. Phone: 1-406-2434529. ORCID

Yoon Hee Cho: 0000-0002-4290-7140 Funding

This work was supported by National Institute of Environmental Health Science (R01 ES023209), National Institute of General Medical Sciences (P30 GM103338), and Seed Grant of University of Montana (UGP-M25391). The contents of this publication are solely the responsibility of the authors and do not necessarily represent the official views of the NIH, NIGMS, or NIEHS. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS The authors thank Virginia Kay, Lou Herritt, Melisa Schelvan, and the UM Center for Environmental Health Sciences Fluorescence Cytometry Core and Molecular Histology and Fluorescence Imaging Core for their varied expert technical assistance with different aspects of this manuscript. Especially, E.C. is a recipient of the Leon Washut Scholar Award, and we appreciate Leon Washut for the great support.

■

ABBREVIATIONS MWCNTs, multiwalled carbon nanotubes; ENM, engineered nanomaterials; NL, narrow long; NS, narrow short; WS, wide short; LLF, lung lavage fluid; DM, dispersion media; PBS, phosphate buffered saline; HE, hematoxylin and eosin; ELISA, enzyme-linked immunosorbant assay; LUMA, luminometric methylation assay; IL-1β, Interleukin-1β; IL-6, Interleukin-6; TNF-α, tumor necrosis factor α; Thy-1, thymus cell antigen 1; 5-mC, 5-methylcytosine

■

REFERENCES

(1) Cattaneo, A. G., Gornati, R., Sabbioni, E., Chiriva-Internati, M., Cobos, E., Jenkins, M. R., and Bernardini, G. (2010) Nanotechnology and human health: risks and benefits. J. Appl. Toxicol. 30 (8), 730− 744. 1552

DOI: 10.1021/acs.chemrestox.9b00075 Chem. Res. Toxicol. 2019, 32, 1545−1553

Article

Chemical Research in Toxicology

Walled Carbon Nanotube Exposure. J. Nanosci. Nanotechnol. 16 (8), 8787−8795. (19) Cohen, P. Y., Breuer, R., and Wallach-Dayan, S. B. (2018) A Profibrotic Phenotype in Naive and in Fibrotic Lung Myofibroblasts Is Governed by Modulations in Thy-1 Expression and Activation. Mediators Inflammation 2018, 4638437. (20) Sanders, Y. Y., Pardo, A., Selman, M., Nuovo, G. J., Tollefsbol, T. O., Siegal, G. P., and Hagood, J. S. (2008) Thy-1 promoter hypermethylation: a novel epigenetic pathogenic mechanism in pulmonary fibrosis. Am. J. Respir. Cell Mol. Biol. 39 (5), 610−618. (21) Sanders, Y. Y., Ambalavanan, N., Halloran, B., Zhang, X., Liu, H., Crossman, D. K., Bray, M., Zhang, K., Thannickal, V. J., and Hagood, J. S. (2012) Altered DNA methylation profile in idiopathic pulmonary fibrosis. Am. J. Respir. Crit. Care Med. 186 (6), 525−535. (22) Song, L., Weng, D., Liu, F., Chen, Y., Li, C., Dong, L., Tang, W., and Chen, J. (2012) Tregs promote the differentiation of Th17 cells in silica-induced lung fibrosis in mice. PLoS One 7 (5), e37286. (23) Hamilton, R. F., Jr., Buford, M., Xiang, C., Wu, N., and Holian, A. (2012) NLRP3 inflammasome activation in murine alveolar macrophages and related lung pathology is associated with MWCNT nickel contamination. Inhalation Toxicol. 24 (14), 995−1008. (24) Yasmin, R., Siraj, S., Hassan, A., Khan, A. R., Abbasi, R., and Ahmad, N. (2015) Epigenetic regulation of inflammatory cytokines and associated genes in human malignancies. Mediators Inflammation 2015, 201703. (25) Dinarello, C. A. (2011) Interleukin-1 in the pathogenesis and treatment of inflammatory diseases. Blood 117 (14), 3720−3732. (26) Martinez, G. J., Nurieva, R. I., Yang, X. O., and Dong, C. (2008) Regulation and function of proinflammatory TH17 cells. Ann. N. Y. Acad. Sci. 1143, 188−211. (27) Zuo, H. P., Guo, Y. Y., Che, L., and Wu, X. Z. (2016) Hypomethylation of Interleukin-6 Promoter is Associated with the Risk of Coronary Heart Disease. Arq Bras Cardiol 107 (2), 131−136. (28) Kendall, R. T., and Feghali-Bostwick, C. A. (2014) Fibroblasts in fibrosis: novel roles and mediators. Front. Pharmacol. 5, 123. (29) Brown, D. M., Donaldson, K., Borm, P. J., Schins, R. P., Dehnhardt, M., Gilmour, P., Jimenez, L. A., and Stone, V. (2004) Calcium and ROS-mediated activation of transcription factors and TNF-alpha cytokine gene expression in macrophages exposed to ultrafine particles. Am. J. Physiol Lung Cell Mol. Physiol 286 (2), L344−L353. (30) Baccarelli, A., Wright, R. O., Bollati, V., Tarantini, L., Litonjua, A. A., Suh, H. H., Zanobetti, A., Sparrow, D., Vokonas, P. S., and Schwartz, J. (2009) Rapid DNA methylation changes after exposure to traffic particles. Am. J. Respir. Crit. Care Med. 179 (7), 572−578. (31) Gong, C., Tao, G., Yang, L., Liu, J., Liu, Q., and Zhuang, Z. (2010) SiO(2) nanoparticles induce global genomic hypomethylation in HaCaT cells. Biochem. Biophys. Res. Commun. 397 (3), 397−400. (32) Weigel, C., Schmezer, P., Plass, C., and Popanda, O. (2015) Epigenetics in radiation-induced fibrosis. Oncogene 34 (17), 2145− 2155. (33) Wilson, M. S., and Wynn, T. A. (2009) Pulmonary fibrosis: pathogenesis, etiology and regulation. Mucosal Immunol. 2 (2), 103− 121. (34) Levy, B. D., and Serhan, C. N. (2014) Resolution of acute inflammation in the lung. Annu. Rev. Physiol. 76, 467−492. (35) Oner, D., Moisse, M., Ghosh, M., Duca, R. C., Poels, K., Luyts, K., Putzeys, E., Cokic, S. M., Van Landuyt, K., Vanoirbeek, J., Lambrechts, D., Godderis, L., and Hoet, P. H. (2017) Epigenetic effects of carbon nanotubes in human monocytic cells. Mutagenesis 32 (1), 181−191. (36) Booth, M. J., Ost, T. W., Beraldi, D., Bell, N. M., Branco, M. R., Reik, W., and Balasubramanian, S. (2013) Oxidative bisulfite sequencing of 5-methylcytosine and 5-hydroxymethylcytosine. Nat. Protoc. 8 (10), 1841−1851.

(2) Wang, X., Katwa, P., Podila, R., Chen, P., Ke, P. C., Rao, A. M., Walters, D. M., Wingard, C. J., and Brown, J. M. (2011) Multi-walled carbon nanotube instillation impairs pulmonary function in C57BL/6 mice. Part. Fibre Toxicol. 8, 24. (3) Savolainen, K., Alenius, H., Norppa, H., Pylkkanen, L., Tuomi, T., and Kasper, G. (2010) Risk assessment of engineered nanomaterials and nanotechnologies–a review. Toxicology 269 (2−3), 92− 104. (4) Lanone, S., Andujar, P., Kermanizadeh, A., and Boczkowski, J. (2013) Determinants of carbon nanotube toxicity. Adv. Drug Delivery Rev. 65 (15), 2063−2069. (5) Hamilton, R. F., Jr., Wu, Z., Mitra, S., Shaw, P. K., and Holian, A. (2013) Effect of MWCNT size, carboxylation, and purification on in vitro and in vivo toxicity, inflammation and lung pathology. Part. Fibre Toxicol. 10 (1), 57. (6) Feinberg, A. P. (2007) Phenotypic plasticity and the epigenetics of human disease. Nature 447 (7143), 433−440. (7) Chatterjee, N., Yang, J., Kim, S., Joo, S. W., and Choi, J. (2016) Diameter size and aspect ratio as critical determinants of uptake, stress response, global metabolomics and epigenetic alterations in multi-wall carbon nanotubes. Carbon 108, 529−540. (8) Jones, P. A. (2012) Functions of DNA methylation: islands, start sites, gene bodies and beyond. Nat. Rev. Genet. 13 (7), 484−492. (9) Sierra, M. I., Rubio, L., Bayon, G. F., Cobo, I., Menendez, P., Morales, P., Mangas, C., Urdinguio, R. G., Lopez, V., Valdes, A., Vales, G., Marcos, R., Torrecillas, R., Fernandez, A. F., and Fraga, M. F. (2017) DNA methylation changes in human lung epithelia cells exposed to multi-walled carbon nanotubes. Nanotoxicology 11 (7), 857−870. (10) Tabish, A. M., Poels, K., Byun, H. M., Luyts, K., Baccarelli, A. A., Martens, J., Kerkhofs, S., Seys, S., Hoet, P., and Godderis, L. (2017) Changes in DNA Methylation in Mouse Lungs after a Single Intra-Tracheal Administration of Nanomaterials. PLoS One 12 (1), e0169886. (11) Oner, D., Ghosh, M., Bove, H., Moisse, M., Boeckx, B., Duca, R. C., Poels, K., Luyts, K., Putzeys, E., Van Landuydt, K., Vanoirbeek, J. A., Ameloot, M., Lambrechts, D., Godderis, L., and Hoet, P. H. (2018) Differences in MWCNT- and SWCNT-induced DNA methylation alterations in association with the nuclear deposition. Part. Fibre Toxicol. 15 (1), 11. (12) Cole, E., Brown, T. A., Pinkerton, K. E., Postma, B., Malany, K., Yang, M., Kim, Y. J., Hamilton, R. F., Jr., Holian, A., and Cho, Y. H. (2017) Perinatal exposure to environmental tobacco smoke is associated with changes in DNA methylation that precede the adult onset of lung disease in a mouse model. Inhalation Toxicol. 29 (10), 435−442. (13) Brown, T. A., Lee, J. W., Holian, A., Porter, V., Fredriksen, H., Kim, M., and Cho, Y. H. (2016) Alterations in DNA methylation corresponding with lung inflammation and as a biomarker for disease development after MWCNT exposure. Nanotoxicology 10 (4), 453− 461. (14) Christensen, S., Jaffar, Z., Cole, E., Porter, V., Ferrini, M., Postma, B., Pinkerton, K. E., Yang, M., Kim, Y. J., Montrose, L., Roberts, K., Holian, A., and Cho, Y. H. (2017) Prenatal environmental tobacco smoke exposure increases allergic asthma risk with methylation changes in mice. Environ. Mol. Mutagen 58 (6), 423−433. (15) Mohsen, K., Johansson, S., and Ekstrom, T. J. (2006) Using LUMA: a Luminometric-based assay for global DNA-methylation. Epigenetics 1 (1), 45−48. (16) Karimi, M., Johansson, S., Stach, D., Corcoran, M., Grander, D., Schalling, M., Bakalkin, G., Lyko, F., Larsson, C., and Ekstrom, T. J. (2006) LUMA (LUminometric Methylation Assay)–a high throughput method to the analysis of genomic DNA methylation. Exp. Cell Res. 312 (11), 1989−1995. (17) Fazzari, M. J., and Greally, J. M. (2004) Epigenomics: beyond CpG islands. Nat. Rev. Genet. 5 (6), 446−455. (18) Lee, J. W., Brown, T. A., Holian, A., Schelvan, M., Porter, V., and Cho, Y. H. (2016) Alterations in DNA Methylation Correlate with a Th17 Driven Immune Response in the Lung Due to Multi1553

DOI: 10.1021/acs.chemrestox.9b00075 Chem. Res. Toxicol. 2019, 32, 1545−1553