Protein-Induced Fluorescence Enhancement Based Detection of

Subscriber access provided by Kaohsiung Medical University

Article

Protein induced fluorescence enhancement based detection of P. falciparum glutamate dehydrogenase using carbon dot coupled specific aptamer. Naveen Kumar Singh, Babina Chakma, Priyamvada Jain, and Pranab Goswami ACS Comb. Sci., Just Accepted Manuscript • DOI: 10.1021/acscombsci.8b00021 • Publication Date (Web): 03 May 2018 Downloaded from http://pubs.acs.org on May 4, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 19 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Combinatorial Science

Protein induced fluorescence enhancement based detection of P. falciparum glutamate dehydrogenase using carbon dot coupled specific aptamer. Naveen Kumar Singh, Babina Chakma, Priyamvada Jain and Pranab Goswami* Department of Biosciences and Bioengineering, Indian Institute of Technology Guwahati, Pin: 781039 Assam, India.

*Correspondence: Fax: +91 361 2582249; Tel: +91 361 2582202; E-mail: [email protected] (P. Goswami)

ACS Paragon Plus Environment

ACS Combinatorial Science 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract A novel 90 mer long ssDNA aptamer (NG3) covering a 40 mer random region targeting Plasmodium falciparum glutamate dehydrogenase (PfGDH) developed through systematic evolution of ligands by exponential enrichment (SELEX) technique. The binding affinity of the aptamer to PfGDH discerned by circular dichroism (CD) was 0.5 ± 0.04 µM. The specificity of the aptamer towards the target was confirmed by gel electrophoresis and CD studies. The presence of two quadruplex forming regions, two big and four small stem loop structures with a δG of -7.99 kcal mole-1 for NG3 were deduced by computational studies. The spherical carbon dots (Cdots) of size 2-4nm, synthesized by pyrolysis method using LGlutamate as a substrate were covalently linked to the amine modified aptamer. The Cdot with a band gap of 2.8 eV and a quantum yield of 34 % produced fluorescence at ~ λ410nm when excited at λ320nm. The quantum yield of Cdot-aptamer assembly was increased upto 40 % in presence of the PfGDH in solution. A linear relationship with a dynamic range of 0.5nM to 25nM (R2 = 0.98) and a limit of detection (LOD) of 0.48 nM was observed between the fluorescence intensity of the Cdots-aptamer conjugate and the concentration of PfGDH. The method could detect PfGDH with an LOD of 2.85 nM in diluted serum sample. This novel simple, sensitive and specific protein induced fluorescence enhancement based detection of PfGDH has a great potential to develop as a method for malaria detection.

Key words: Carbon dots, Plasmodium falciparum, glutamate dehydrogenase, protein induced fluorescence enhancement, aptamer, SELEX, malaria detection.


Page 2 of 19

Page 3 of 19 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Introduction A continuous effort has been made over the last few decades to eradicate malaria as evident from the large volume of experimental papers and patents published till date in various global publishing platforms. However, the parasitic disease still poses a great threat to the mankind particularly in malaria endemic countries. Malaria caused by P. falciparum species is the most dreaded one causing highest rates of morbidity and mortality.1 Rapid, reliable, and economical malaria diagnoses are important requirements for the better management of this life-threatening disease occurring mostly in tropical countries with poor economic status. Exploring efficient biorecognition system and reliable biomarker are the on-going research aggressively being pursued globally to design and develop flawless malaria detection system for deployment in point of care testing (POCT) systems in resource limiting malaria infested regions.2 Among the different methods currently available for rapid detection of malaria, the lateral flow format based rapid detection tests (RDTs) are widely used in malaria endemic regions. Although these antibody-based RDTs have substantially reduced the clinical burden on malaria diagnosis, the tests suffers from many drawbacks among which, non-quantitative, limited species differentiation, poor performance in hot and humid climate, and variability of results are prominent which prompted to explore more efficient low cost portable detection system for malaria.3 Many malaria biomarkers have been reported among which Histidine rich protein-II (HRPII), has been the target in most of the RDT based detection of P. falciparum infections.2 However, there is a rising frequency of HRP II gene deletions primarily in Amazon regions and in many African, Asian countries that demand a test for non-HRP II falciparum-specific targets.4 In this regard, P. falciparum glutamate dehydrogenase (PfGDH) (EC no. 1.4.1.4; PlasmoDB accession no.PF3D7_1416500) may be projected as an alternative malaria biomarker for specific detection of the falciparum-specific targets.5,

6

The strength of this

PfGDH biomarker is founded by the fact that the host counterpart of this enzyme, the human glutamate dehydrogenase (HGDH), is not present in the human erythrocyte where PfGDH is released by the parasite.5 Moreover, it has some distinctive structural, compositional and functional features from the HGDH.7-9 This homo-hexameric protein (Mw 49.5 kDa per subunit) shares only 23 % overall amino acid sequence identity with HGDH and 69 % match with Plasmodium vivax GDH. The crystal structure of this enzyme was solved at 2.7Å resolution.7 PfGDH is present in soluble form throughout the sexual and asexual stages of the parasite development and is present in significant quantity in the blood serum of the malaria



patients.10 Few reports on the malarial diagnostic applications with PfGDH biomarker are available among which antibody based colloidal gold immune chromatographic method is prominent.11,

12

However, the commercial applications of this diagnostic technique are not

adequately known. Various recognition systems as alternative to antibody for point of care malaria diagnosis have been reported.13-15 Among the new generation of biorecognition systems, aptamers have drawn special attentions owing to their certain properties that fair well over the conventional antibody based systems for developing bio-detection systems.16 The nucleic acid aptamers are single-stranded oligonucleotides that are selected through an enrichment technique from a pool of oligonucleotide library in presence of the target following a widely acclaimed process called SELEX (systemic evaluation of ligand by exponential enrichment).17,18 One of the most critical requirements in developing rapid detection tests and biosensors is the generation of noise free decipherable signal from the specific interaction of the biorecognition elements with the targets of interest. These interactions could be transduced to different signal forms among which, the fluorescence based optical signal systems have received intensive interest in the field of rapid detection tests due to their high sensitivity, scope for real-time analysis of the target in complex mixtures, and requirement of small sample volumes.19-21 Carbon dot (Cdot) is a recent development on this field and is evolved as a fluorophore with various positive traits, such as, high quantum yield, broad excitation wave length, easy surface modification, resistance against photo bleaching and simple green synthesis process.22 Herein, we report a novel specific aptamer selected through the SELEX process against the malarial biomarker PfGDH. Following a simple chemistry, the aptamer was chemically conjugated to Cdots, which were synthesised following a straight forward pyrolysis method from a widely available amino acid. The synthesised Cdot-aptamer was then used as biorecognition cum fluorescence reporter assembly for quantitative detection of

PfGDH protein in serum sample following the protein induced fluorescence enhancement (PIFE) phenomena. The PIFE is a photophysical phenomenon usually employed to study protein–nucleic acids interactions such as, for monitoring directional movement of DNA motor proteins in ensemble and for following the dynamics of nucleic acid polymerases on DNA.23, 24 The results showed that the fluorescence enhancement was directly proportional to the protein concentrations in solution in a wide protein concentration range with a detection


Page 4 of 19

Page 5 of 19 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


capability down to nano-molar range. A detailed account on the findings is incorporated in this paper.

Experimental Methods SELEX methodology SELEX was performed to select specific ssDNA aptamers against PfGDH protein using an aptamer library (~1014–1015), which was conferred by a 40-mer long random sequence of the ssDNA flanked by constant primer binding regions for amplification as follows: 5'CACCTAATACGACTCACTATAGCGGATCCGA-N40-CTGGCTCGAACAAGCTTGC3'. Before use, 5 nmole of ssDNA was suspended in 1ml of the binding buffer and heated for 10 min at 90 °C and then cooled to RT. At the same time, PfGDH protein (1mg.ml-1) was immobilized on a PVDF membrane (5mm dia) in the binding buffer for 1h followed by washing with the buffer for 1 min and stored at 4 °C. The heat treated ssDNA library was also kept for immobilization over PVDF membrane for 10 min as a negative selection against the membrane and then the unbound aptamer was used for the first round positive selection against PfGDH. The stringency of aptamer binding with PfGDH/ PVDF membrane was increased by decreasing the binding time, from 60 min to 10 min with a depreciation of 5 min for each cycle, from 6th to 17th cycle. The bound aptamer was eluted with PCR grade water at 90 °C for 5 min and then amplified by PCR with initial denaturation at 95 °C for 10 mins, followed by 20 cycles of 95 °C for 15 s, 68 °C for 15 s, 72 °C for 3 s, and final extension at 72 °

C for 3 s. The amplified product was then incubated with 25 µl streptavidin magnetic beads

in coupling buffer at RT for 1 h. The ssDNA strands were then separated from the biotinylated strands using 100 µl of 100 mM NaOH and used for the next round of cycle. A total of 17 SELEX cycles were performed out of which 3 against PVDF membrane as counter SELEX after (6th, 8th, 10th cycle) and 2 against HGDH as negative SELEX at the end of 13th, 15th cycles. After the 17 cycle of SELEX, amplified product was cloned into the pGEMT vector and transformed into Top 10 competent cells. All the primers and buffers used for the present work are presented in the supporting information (Table S1 and Table S2). Circular dichroism (CD) studies The CD study was performed to measure the binding affinity of the aptamer to the target protein. The CD spectra were recorded on Jasco J-815 spectropolarimeter (Japan) at RT in 1 cm path length cuvette. The spectra were recorded in continuous mode with a resolution of 1



Page 6 of 19

nm between 250 to 300 nm at a scan rate of 100 nm min-1. Induced CD (ICD) spectra were recorded for dissociation constant (Kd) measurement of aptamers after its binding with

PfGDH protein at increasing concentration. The buffer influence was removed from the recorded spectra and smoothened by Savitsky-Golay algorithm through Origin 8.0 software. The Kd value of the aptamer was calculated by plotting a graph of peak intensity versus concentration gradient of PfGDH and fitted in single ligand binding model of Sigma plot. For the measurement, 4 µM of aptamer was heated at 95 °C for 10 min and then incubated at 4 °C for 30 min followed by incubating the aptamer solution with various concentration of PfGDH for 1 h. Analysis of aptamer structure The folding of aptamer sequence into secondary structure was predicted by Mfold web server.25 The ionic condition for Mfold study was chosen as the same used for SELEX binding buffer at 25 °C. The QGRS (Quadruplex forming G-Rich Sequences) mapper was used to analyse the aptamer sequence for quadruplex forming region by choosing default condition of online software (i.e with maximum QGRS length of 30, minimum G-group of 2 and loop size between 0 and 36 nucleotides).26 The 3D structure of aptamer was analysed through RNA composer software27 by using Mfold dot bracket annotation

as input

considering the fact that the 3D confirmation folding of ssDNA takes place almost the same way as for RNA folding.18 Docking of PfGDH (PDB ID: 2BMA) and 3D structure of aptamer were performed through Autodock online server based on shape complementary principle28 and visualization and analysis by PyMOL software. The surface interaction between amino acid and nucleotide were analysed through protein ligand interaction programme.29

Preparation of Cdot-aptamer conjugates The Cdots were synthesized from L-glutamate through pyrolysis process and characterized through various techniques (Supporting information S1.5). The Cdots were covalently linked to 5'- amine modified aptamer using EDC-NHS covalent chemistry. The Cdots (1mg.ml-1) were incubated with 0.1 M morpholino-ethanesulfonic acid (MES) buffer, pH 6.0 along with 2 mM EDC (1-ethyl-3-(3-dimethylamino propyl) carbodiimide) and 5 mM NHS (Nhydroxysulfosuccinimide) reagents for 30 min with gentle mixing followed by addition of binding buffer slowly into the system. Then 0.5 µM 5' NH2-aptamer from stock solution of 100µM in binding buffer was added to the solution and incubated for 2 h. Before the ACS Paragon Plus Environment

Page 7 of 19 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


attachment of Cdot, the aptamer was treated at 90 °C for 10 min followed by incubation in ice for 4 min. To block the free carboxylic groups, the solution was treated with 1 % ethanolamine for 1h at 4 °C. The Cdot-aptamers conjugates were then purified by 5 kDa cutoff centrifugation filter to remove uncoupled Cdots and excess chemical reagents. Detection of PfGDH through Cdot-aptamer conjugate. The PfGDH samples, either dissolved in the binding buffer or spiked in four fold diluted human serum, were added to 100 µl of Cdot-aptamer conjugate and then made-up the volume to 1ml with binding buffer. The mixture was incubated for different time intervals and then recorded the fluorescence emission spectra (Excitation at λ320nm and emission at λ350nm λ600nm) in Fluromax-4 (Horiba USA). The specificity of the assay was also checked with different analogous potential interfering proteins. Each measurement was performed in triplicate to estimate the standard deviation of the results. Results and Discussion Preparation and characterization of PfGDH and HGDH The malarial biomarker, PfGDH and the analogous protein from human counterpart, HGDH were successfully cloned, expressed, purified, and then confirmed the expressed proteins by Western Blot (Figure S1A-C). The purification yield for PfGDH and HGDH were ~ 12 mg L-1 and ~ 3 mg L-1, respectively. The homo hexameric PfGDH protein expressed in monomeric form from the clone was later assembled into the hexameric form in 50 mM potassium phosphate buffer, pH 8.0. The integrity of the oligomeric form of PfGDH was confirmed by sedimentation velocity study. The PfGDH sample was found to be largely homogeneous in nature with the major fraction (~95 %) accounted by the homohexameric form (~306 kDa) of the protein (Figure S2). A minor heterogeneity obtained was roughly correspond to the monomeric form of the PfGDH protein (~47.5kDa). To study the structural intergrity of the expressed PfGDH and HGDH proteins, CD analysis was performed (Figure S1D). The analysis showed that PfGDH constitutes ~28 % α helix, ~5 % β sheet, 30 % turns and 37 % random coil, whereas GDH constitutes ~27 % α helix, ~58 % β sheet, ~15 % random coil. The results corelates well with the previous reports.30, 31 The Km values for the substrate L-glutamate discerned for the recombinant PfGDH and HGDH using lineweaver burk plot were 6.9±0.38 mM, and 4.36±0.18 mM, respectively. The activity of recombinant enzymes is in fair agreement with previously reported Km values



1.05±0.25 and 10.8±3.3 for PfGDH and HGDH respectively.5, 32 The results confirmed that both the expressed proteins were well folded and enzymatically active.

Development of specific aptamer against PfGDH Specific aptamer against PfGDH was selected from an ssDNA library through SELEX process. To perform the SELEX, the protein (PfGDH or HGDH) was immobilized on PVDF membrane. The reason for selecting PVDF membrane was based on the fact that the proteins get immobilized on this membrane in a non-uniform manner through various combinations of weak forces,33 which enhances the probability of forming a wider array of aptatopes for increased interactions with the potential aptamer candidates. The surface modification of PVDF membrane by protein and aptamer binding was characterized by AFM (Figure S3). A total 17 rounds of SELEX cycle was performed, out of which 5 cycles were performed for the blank PVDF membrane and HGDH protein to prevent enrichment of non-specific aptamer candidates against the target. Following each positive cycle, a gradual enrichment of aptamer candidates was occurred as visible from the increased in band intensity in the gel (Figure 1A). The enriched candidates were cloned, transformed into competent cells and then screened for the positive insert through blue white screening protocol. The positive clones were digested with EcoR1 and then analyzed in gel (Figure S4). The intense bands from the gel were isolated, and sequenced. The sequencing result revealed that out of 22 positive clones only 16 clones carried the proper aptamer insert. Analysis of the selected sequences by clustal X2 unveiled that two types of sequences were enriched better than the rest of the aptamer candidates out of which the candidates NG3 and NG51 were selected for further studies (Figure 1B and Table S3). The alignment studies of these sequences did not display any conservation in the random regions of the sequences. The secondary structures of NG3 and NG51 were predicted by using Mfold. The δG values for NG3 and NG51 were deduced as -7.99 and -4.68 Kcal mole-1, respectively. NG3 has two big loops with four small stem loop structures, connected through single straight long arm; whereas, NG51 has one big loop structure with three small stem loop structures, connected through the small arm (Figure 1C). Analysis of NG3 and NG51 aptamer sequence revealed the presence of various repeats of guanine (G) nucleotide which may contribute to the formation of G-quadruplex. The QGRS mapper analysis predicted the presence of two quadruplex forming regions in NG3 (Table 1), while it was absent in NG51. The QGRS mapper results were braced with CD spectroscopy study. The CD spectra of NG3 exhibit a


Page 8 of 19

Page 9 of 19 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


positive peak at ~ 265 nm and negative peak at ~240 nm which are characteristic of a antiparallel G qudraplex structure.34 Further, such observations were absent in NG51 (Figure S5A). The δG value and G qudraplex forming capability indicate that aptamer NG3 has higher thermal stability as compare to NG51. G quadruplex structure is also known to provide protection from nucleases.35 The binding affinity of the two positive aptamer candidates with the target as well as control proteins (PfLDH, PfHRP-II and HSA) were then investigated by CD. Both the aptamers could change the ellipticity of the PfGDH protein following their interactions validating the conclusive binding functions of the aptamers. The aptamers did not significantly change the ellipticity of the control proteins (PfLDH, PfHRP-II and HSA) indicating their specific nature (Figure 2). An increase in CD peak intensity on the binding of aptamers with the increasing concentrations of PfGDH was utilized to determine the dissociation constants (Kd) of the aptamers. An increase in ICD signal upon increase in protein concentration is a direct indication of protein aptamer interaction.36 The determined Kd values were 0.5 ± 0.04 µM and 1.1 ± 0.20 µM for NG3 and NG51, respectively (Figure S5B). Taking into account the above findings and the lower Kd values, the aptamer NG3 was considered for further studies. The specificity of the NG3 was further evaluated by EMSA and the results validated specific binding of NG3 to PfGDH as visible from the increase in the intensity of the aptamer-protein complex band with increasing concentrations of the PfGDH protein. There was no reactivity of the aptamer with HGDH protein (Figure S5C).

Characterization of Cdot-aptamer conjugates The size of the synthesized Cdots was in the range of 2-4 nm with an average band gap of 2.8 eV (Figure S6). The FTIR absorbance peaks of NG3 at ~1620 cm-1 and ~3400 cm-1 can be assigned to N-H stretching of primary amine and –OH group, respectively (Figure S7). The interaction of the amine modified NG3 aptamer with Cdots was confirmed by characteristic amide bond peak at ~1680 cm-1 (C=O group of amide) and ~1560 cm-1 (-NH bending vibration of amine) which established the covalent interaction between Cdots and NG3 aptamer. The presence of aptamer stretching vibration at ~ 1065 cm-1 and ~1105 cm-1 were assigned to the respective functional groups P-O/C-O, and PO2- symmetric bonds originated from aptamers phosphodiester backbone in the Cdot-aptamer assembly that confirmed the coupling of aptamer with Cdots. Besides the covalent binding between carbon dot and aptamer some other interactions that support the carbon dot-aptamer binding in buffer



condition such as, dipole bond, hydrogen bond and ionic/electrostatic interaction can’t be ruled out. The band gap of the conjugate however, was not deviated from the value detected for the pure Cdots.

FRET-based detection of PfGDH using Cdot-aptamer conjugate

Fluorescence resonance energy transfer (FRET) is a widely used sensing technique in which two fluorescence molecules are generally used, one act as donor while the other act as acceptor of the light energy at a defined distance. Application of FRET for detection of protein is difficult due to the complex and inefficient methods available for protein tagging and selection of acceptor and donor partner. Herein, a protein induced fluorescence enhancement (PIFE) phenomenon for the Cdots was achieved when the Cdot-aptamer assembly interacted with the target PfGDH protein in solution (Scheme 1). Hence, unlike previous studies the strategy did not involve additional steps of chemical tagging of the protein with Cdots to acquire the PIFE phenomenon.37 The synthesized Cdots exhibited strong fluorescence in the spectral range of λ350nm - λ600nm with the peak intensity centered on ~ λ410nm when it was excited at λ320nm. The characteristic excitation and emission wavelengths were not altered even when the Cdots were chemically coupled to the aptamers to produce the Cdot-aptamer assembly; which indicates that the chemical surface modification of Cdots for linking the aptamer did not affect the optical properties of this carbon based nanomaterial. Interestingly, the fluorescence intensity of the Cdot-aptamer assembly was markedly enhanced by their interaction with the target PfGDH proteins in solution. Notably, the intrinsic fluorescence of the target protein was observed at a shorter wavelength (~λ385nm) with very low intensity and quantum yield (6%); hence the observed enhancement of fluorescence intensity of the Cdot-aptamer assembly excludes the intrinsic fluorescence of the PfGDH protein (Figure 3). The Quantum yield of the Cdots was 34 %, which did not significantly changed in Cdot-aptamer assembly. However, in presence of PfGDH the quantum yield of Cdot-aptamer increased to 40 %. A clear enhancement of fluorescence of Cdot-aptamer assembly on its interaction with the PfGDH is visible from the spectra, which is attributed to the protein induced fluorescence enhancement (PIFE) phenomenon. Optimum binding time for Cdot-aptamer with PfGDH was analyzed and discerned as 30 min (Figure S8A). Based on this result, the Cdot-aptamer assembly was used to detect PfGDH by monitoring the fluorescence emission at λ410 nm at the excitation of λ320 nm. The PIFE in terms


Page 10 of 19

Page 11 of 19 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


of relative fluorescence of Cdot-aptamer complex was studied with varying concentrations of spiked PfGDH in buffer (Figure 4A). The relative fluorescence intensity was calculated by using the relation: (Ft-Fb/Fb) where Ft is the fluorescence intensity of the conjugate (Cdotaptamer/PfGDH), and Fb is the fluorescence intensity of the Cdot-aptamer complex (as blank). From the calibration curve (Figure 4B) a linear detection range of 0.5 nM - 25 nM and a limit of detection (LOD= 3xSD/slope) of 0.48 nM for PfGDH (R2 = 0.98) were discerned in buffer. The detection of PfGDH in serum sample was also analysed by spiking different concentration of PfGDH (1nM to 25nM) in the 4-fold diluted serum serum (Figure S8B) and discerned LOD of 2.85 nM (R2 = 0.98) with a linear dynamic range of 1nM - 25 nM (Figure 4C). The high LOD in the serum has been attributed to its complex nature containing abundant amount of different proteins and ions, which is likely to interfere the fluorescence signal. Nevertheless, the level of sensitivity detected falls within the clinical range (2 to 16 nM) of PfGDH present in malaria patient.12, 38 The dynamic range obtained through this investigation is superior to previously reported antibody-based dipstick method.11 The G-quadruplex structure of the aptamer provides a hydrophobic microenvironment to the conjugated Cdot, which facilitates the binding and sheltering of the Cdot-aptamer complex in the hydrophobic pocket of PfGDH as reported for other cases.39,

40

This sheltering might

support surface stabilization of Cdots by partial passivation and enabling more efficient radiative recombination between electron and holes, the primary reason for Cdots fluorescence property.41-43 This hypothesis was supported by the time resolved fluorescence analysis. The Cdots life time of 2.69±0.55 ns was correspondingly increased to 2.85±0.67 ns and 3.32±0.52 ns following its interaction with aptamer and PfGDH (Table S4). The florescence lifetime increased in less polar environment because the lower dipole moments of surrounding molecule lead to decrease the efficiency of energy transfer.44 The confinement of Cdot-aptamer into hydrophobic pocket of PfGDH was also supported by the molecular docking studies (Figure S9 and Table S5). The specificity of Cdot-aptamer was analysed in the presence of analogous malarial marker proteins PfLDH, PfHRP-II and other two nonspecific human proteins, HSA and HGDH at a concentration of 10 nM for each in the sample (Figure 4D). The signal to noise ratio calculated with equation (1). Fluorescence of Cdot-aptamer/protein and Cdot-aptamer has considered as target and background signal respectively.



The signal to noise ratio were 1138.29, 141.17, 266.25, 97.98 and 87.65 for PfGDH, PfLDH,

PfHRP-II, HGDH and HSA, respectively. This indicates a highly selective PIFE response of the Cdot-aptamer conjugate for the target PfGDH protein.

Conclusion The PfGDH and HGDH were successfully cloned and expressed in soluble form. The structural and functional integrity of the expressed recombinant proteins were confirmed by physical and enzymatic methods. A novel and specific ssDNA aptamer (NG3) against the

PfGDH protein was developed through a rational approach following SELEX technique. The aptamer offered a dissociation constant (Kd) of 0.5 µM for the target. The aptamer was chemically conjugated to a Cdots, which was chemically synthesized from monosodium Lglutamate through a bottom up approach. The Cdot-aptamer assembly was successfully employed to sensitively detect PfGDH by using a principle of protein-induced fluorescence enhancement (PIFE) phenomenon. The detection approach was further validated in human serum sample with spiked PfGDH. This novel detection method holds promise for sensitive detection of P. falciparum malaria. The dynamic range obtained in this study covers the pathological concentration of PfGDH in malaria patient. The presence of major interfering proteins PfLDH, PfHRP-II, HGDH, and HSA showed lack of or poor influence on the response. The mechanism involved in PIFE has been elucidated and ascribed to the interaction of the Cdots with the hydrophobic cohort comprising of G-quadruplex structure of the conjugated aptamer and surrounding molecular environment in the hydrophobic pocket of the target multimeric PfGDH protein. The investigation also explored the key amino acid moieties of the PfGDH protein that participated in the binding with the aptamer. The key moieties involved in the interaction also embolden the proposed hypothesis for PIFE response. The detection method proposed here has potential to be developed into a sensitive, selective and rapid diagnosis method for malaria.


Page 12 of 19

Page 13 of 19 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


ASSOCIATED CONTENT Supporting Information Materials and methods for cloning, expression, purification and charachterization of all proteins; EMSA studies; Cdot synthesis and characterizations; list of primers and buffers. Results on cloning, expression and characterization of proteins; AFM studies; screening of TA clones for aptamers candidates; secondary structure and binding constant for aptamers; characteristics of Cdots; time optimization for PIFE; detection of PfGDH in serum; docking studies for aptamer with PfGDH.

Acknowledgement: We acknowledge the financial assistance (Grant No. BT/PR13560/ COE/34/44/2015 Project II) of Department of Biotechnology, Govt of India.

References 1. World Malaria Report; World Health organization. 2016, 243. doi:ISBN 978 92 4 1564403. 2. Jain, P.; Chakma, B.; Patra, S.; Goswami, P. Potential biomarkers and their applications for rapid and reliable detection of malaria. Biomed. R. Intern. 2014, 2014, 852645. 3. Mouatcho, J. C.; Goldring, J. P. Malaria rapid diagnostic tests, challenges and prospects. J. Med. Microbiol. 2013, 62, 1491–1505. 4. Bharti, P. K.; Chandel, S. H.; Ahmad, A.; Krishna, S.; Kumar, U. V.; Singh, N. Prevalence of pfhrp2 and/or pfhrp3 Gene deletion in Plasmodium falciparum population in eight highly endemic states in India. Plos one. 2016, 11, 0157949. 5. Wagner, J. T.; Lüdemann, H.; Färber, P. M.; Lottspeich, F.; Krauth, R. L. Glutamate dehydrogenase, the marker protein of Plasmodium falciparum cloning, expression and characterization of the malarial enzyme. Eur. J. Biochem. 1998, 258, 813–819. 6. Seol, B.; Shin, H. I.; Kim, J. Y.; Jeon, B. Y.; Kang, Y. J.; Pak, J. H.; Kim, T. S.; Lee, H. W. Sequence conservation of Plasmodium vivax glutamate dehydrogenase among Korean isolates and its application in seroepidemiology. Malar. J. 2017, 16, 3. 7. Werner, C.; Stubbs, M. T.; Krauth, R. L.; Klebe, G. The crystal structure of Plasmodium falciparum glutamate dehydrogenase, a putative target for novel antimalarial drugs. J. Mol. Biol. 2005, 349, 597–607. 8. Storm, J.; Perner, J.; Aparicio, I.; Patzewitz, E. M.; Olszewski, K.; Llinas, M.; Engel, P.C.; Müller, S. Plasmodium falciparum glutamate dehydrogenase a is dispensable and not a drug target during erythrocytic development. Malar. J. 2011, 10, 193. 9. Zaganas, I.; Spanaki, C.; Plaitakis, A. Expression of human GLUD2 glutamate dehydrogenase in human tissues: Functional implications. Neurochem. Int. 2012, 61, 455–462.



10. Dominguez, N.; Rodriguez, A. Glutamate dehydrogenase antigen detection in Plasmodium falciparum infections. Korean J. Parasitol. 1996, 34 (4), 239-46. 11. Li, Y.; Ning, Y. S.; Li, L.; Peng, D. D.; Dong, W. Q.; Li, M. Preparation of monoclonal antibodies against Plasmodium falciparum glutamate dehydrogenase and establishment of colloidal gold- immunochromatographic assay. Di Yi Jun Yi Da Xue Xue Bao. 2005, 25, 435-438. 12. Djadiad, N. D.; Sedighion, F.; Raj, A.; Zakeri, S. Gold nanoparticle based dipstick nano biosensor for detecting Plasmodium falciparum and vivax and method. US patent. 2014, US 2014/0248629 A1. 13. Chakma, B.; Jain, P.; Singh, N. K.; Goswami, P. Development of an indicator displacement based detection of malaria targeting HRP-II as biomarker for application in Point-of-Care Settings. Anal. Chem. 2016, 88 (20), 10316–10321. 14. Lee, S.; Manjunatha, H. D.; Jeon, W.; Ban, C. Cationic surfactant-based colorimetric detection of Plasmodium lactate dehydrogenase, a biomarker for Malaria, using the specific DNA aptamer. Plos one. 2014, 9 (7), e100847. 15. Gulka, C. P.; Swartz, J. D.; Trantum, J. R.; Davis, K. M.; Peak, C. M.; Denton, A. J.; Haselton, F. R.; Wright, D. W. Coffee rings as low-resource diagnostics: Detection of the malaria biomarker Plasmodium falciparum histidine-rich protein-II using a surface- coupled ring of Ni(II)NTA gold-plated polystyrene particles. ACS Appl. Mater. Interfaces. 2014, 6, 6257–6263. 16. Hicke, B. J.; Stephens, A. W. Escort aptamers a delivery service for diagnosis and therapy. J. Clin. Invest. 2000, 106(8), 923-928. 17. Dirkzwager, R. M.; Liang, S.; Tanner, J. A. Development of Aptamer-Based Point-ofCare Diagnostic Devices for Malaria Using Three-Dimensional Printing Rapid Prototyping. ACS Sensors. 2016, 1, 420–426. 18. Kakoti, A.; Goswami, P. Multifaceted analyses of the interactions between human heart type fatty acid binding protein and its specific aptamers. Biochim. Biophys. Acta. Gen. 2017, 1861 (1), 3289-3299. 19. Yue, Q.; Hou, Y.; Yue, S.; Du, K.; Shen, T.; Wang, L.; Xu, S.; Li, H.; Liu, J. Construction of an off-on fluorescence system based on carbon dots for trace pyrophosphate sensing. J. Fluoresc. 2015, 25 (3),585-94. 20. Malica, L.; Kirk, A. G. Integrated miniaturized optical detection platform for fluorescence and absorption spectroscopy. Sensors and Actu. A: Physical. 2006, 135 (2),515-524. 21. Zheng, Q.; Lavis, D. L. Development of photostable fluorophores for molecularimaging. Curr. Opin. Chem. Bio. 2017, 39, 32–38. 22. Zuo, J.; Jiang, T.; Zhao, X.; Xiong, X.; Xiao, S.; Zhu, Z. Preparation and Application of Fluorescent Carbon Dots. J. Nanomater. 2015, 2015, 787862. 23. Hwang, H.; Myong, S. Protein induced fluorescence enhancement (PIFE) for probing protein–nucleic acid interactions. Chem Soc Rev. 2014, 21, 1221–1229. 24. Ploetz, E.; Lerner, E; Husada1, F; Roelfs, M; Chung, S. Y.; Hohlbein, J.; Shimon Weiss, S.; Cordes, T. Förster resonance energy transfer and protein-induced fluorescence enhancement as synergetic multiscale, molecular rulers. Scientific Reports. 2016, 6, 33257. 25. Zuker, M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 2003, 31, 3406–3415. 26. Kikin, O.; Antonio, L.; Bagga, P. S. QGRS Mapper: A web-based server for predicting G-quadruplexes in nucleotide sequences. Nucleic Acids Res. 2006, 34, 676–682.


Page 14 of 19

Page 15 of 19 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


27. Popenda, M.; Szachniuk, M.; Antczak, M.; Purzycka, K. J.; Lukasiak, P.; Bartol, N.; Blazewicz, J.; Adamiak, R. W. Automated 3D structure composition for large RNAs. Nucleic Acids Res. 2012, 40, 1–12. 28. Schneidman, D. D.; Inbar, Y.; Nussinov, R.; Wolfson, H. J. PatchDock and SymmDock: Servers for rigid and symmetric docking. Nucleic Acids Res. 2005, 33, 363–367. 29. Salentin, S.; Schreiber, S.; Haupt, V. J.; Adasme, M. F.; Schroeder, M. PLIP: Fully automated protein-ligand interaction profiler. Nucleic Acids Res. 2015, 43, 443–447. 30. Wells, B. D. Circular Dichroism Estimate of Secondary Structure of Glutamate Dehydrogenase. J. Mol. Biol. 1975, 97, 391-394. 31. Yang, S. J.; Huh, J. W.; Lee, J. E.; Choi, S. Y.; Kim, T. U.; Cho, S. W. Inactivation of human glutamate dehydrogenase by aluminum. Cell. Mol. Life Sci. 2003, 60, 2538– 2546. 32. Shashidharan, P.; Theologos, M. M.; Nikolaos, K. R.; Kresovali, A.; Papamatheakis, J.; Plaitak, A. Novel Human Glutamate Dehydrogenase Expressed in Neural and Testicular Tissues and Encoded by an X-linked Intronless Gene. J.Biol. Chem. 1994, 269 (24), 16971-76. 33. Matsudaira, P. Sequence from picomole quantities of proteins electroblotted onto polyvinylidene difluoride membranes. J. Biol. Chem. 1987, 262, 10035–10038. 34. Nagatoishi, S.; Tanaka, Y.; Tsumoto, K. Circular dichroism spectra demonstrate formation of the thrombin-binding DNA aptamer G-quadruplex under stabilizingcation-deficient conditions. Biochem. Biophys. Res. Commun. 2007, 352, 812–817. 35. Lane, A. N.; Chaires, J. B.; Gray, R. D.; Trent, J. O. Stability and kinetics of Gquadruplex structures. Nucleic Acids Res. 2008, 36, 5482–5515. 36. Garbett, N. C.; Ragazzon, P. A.; Chaires, J. B. Circular dichroism to determine binding mode and affinity of ligand–DNA interactions. Nat. Protoc. 2007, 2, 3166– 3172. 37. Rao, C.; Khan, S.; Verma, N. C.; Nandi, C. K. Labelling Proteins with Carbon Nanodots. ChemBioChem. 2017, 18, 2385 – 2389. 38. Yan, Li.; Shan, N. Y.; Li, L.; Dan, P. D.; Qi, W. D.; Ming, Li. Prepartion of monoclonal antibody against Plasmodium falciparum glutamate dehydrogenase and establisment of gold immunochromatographic assay. J. First. Mil. Med. 2005, 25 (4), 435-443. 39. Cao, L.; Meziani, M. J.; Sahu, S.; Sun, Y. P. Photoluminescence properties of graphene versus other carbon nanomaterials. Acc. Chem. Res. 2013, 46, 171–180. 40. Li, Tao.; Wang, E.; Dong, D. Parallel G-Quadruplex-specific fluorescent probe for monitoring DNA structural changes and fabel-free detection of potassium ion. Anal. Chem. 2010, 82, 7576–7580. 41. Liu, J. M.; Lin, L.; Wang, X. X.; Lin, S. Q.; Cai, W. L.; Zhang, L. H.; Zheng, Z. Y. Highly selective and sensitive detection of Cu2+ with lysine enhancing bovine serum albumin modified-carbon dots fluorescent probe. Analyst. 2012, 137, 2637-2642. 42. Liu, Z.; Jiang, T.; Wang, B.; Ke, B.; Zhou, Y.; Du, L.; Li, M. Environment-Sensitive Fluorescent Probe for the Human Ether-a-go- go-Related Gene Potassium Channel. Anal. Chem. 2016, 88 (3), 1511-1515. 43. Mondal, S.; Thirupathi, R.; Atreya, S. H. Carbon Quantum Dots as a Macromolecular Crowder. J. Name. 2012, 00, 1-3. 44. Elana, M. S.; Ciuba, M. A.; Lin, S.; Levitus, M. Demystifying PIFE: The photophysics behind the protein-induced fluorescence enhancement phenomenon in Cy3. J. Phys. Chem. Lett. 2015, 6, 1819−1823.



Scheme 1. Schematic illustration on the preparation of Cdot-aptamer conjugate and their utilization for the detection of PfGDH in serum following protein based fluorescence enhancement (PIFE) phenomenon.


Page 16 of 19

Page 17 of 19 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figures

Figure 1. The amplified bands at the end of SELEX cycle L1-L17, respectively, M- wide range DNA ladder. The bands on counter SELEX against PVDF after L6, L8, L10 and negative SELEX against HGDH afterL13, L15 are seen (A). The grouping of aptamer sequences on the basis of percentage sequence matches is presented, comparatively more enriched sequences grouped in red, black box (B). Secondary structures of NG3 and NG51 aptamers predicted by mfold software (C).



Figure 2. CD spectra of (A) NG3 and (B) NG51 in the presence of the target protein PfGDH (0µM to 1.0 µM). CD spectra of (C) NG3 and (D) NG51 in presence of PfGDH and control proteins HSA, HRP-II andPfLDH.

Figure 3. Excitation and Emission spectra of Cdot, aptamer, PfGDH, Cdot-aptamer and Cdot-aptamer/PfGDH complex in binding buffer.


Page 18 of 19

Page 19 of 19 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. PIFE of Cdot-aptamer conjugate with increasing concentration of PfGDH protein spiked in binding buffer (A). Calibration plot for PIFE response with PfGDH protein spiked in binding buffer (B). Calibration plot for PIFE response of the Cdot-aptamer conjugate against different concentration of PfGDH spiked in human serum diluted in binding buffer (C). PIFE response of Cdot-aptmer conjugate with different nonspecific malaria (PfLDH,

PfHRP-II) and human (HSA, HGDH) proteins each at a concentration of 10nM spiked in binding buffer (D).

Table 1. G qudruplex structure prediction for the developed aptamer. Aptamer Position NG3 24 57

Length QGRS GGATCCGAGCCGGGGTGTTCTGTTGGCGGG 30 GGTGGGCGGGCTGG 14


G-Score 13 21

Protein-Induced Fluorescence Enhancement Based Detection of

Recommend Documents