FORUM ARTICLE www.acsami.org
Stability, Antimicrobial Activity, and Cytotoxicity of Poly(amidoamine) Dendrimers on Titanium Substrates Lin Wang,†,‡ Uriel J. Erasquin,‡ Meirong Zhao,‡ Li Ren,† Martin Yi Zhang,§ Gary J. Cheng,§ Yingjun Wang,*,† and Chengzhi Cai*,‡ †
Biomaterials Research Center, South China University of Technology, Guangzhou 510640, PR China Department of Chemistry and Center for Materials Chemistry, University of Houston, Houston, Texas 77204-5003, United States § School of Industrial Engineering, Purdue University, West Lafayette, Indiana 47906, United States ‡
bS Supporting Information ABSTRACT: In this article, we present the first report on the antibacterial activity and cytotoxicity of poly(amidoamine) (PAMAM) dendrimers immobilized on three types of titanium-based substrates with and without calcium phosphate coating. We show that the amino-terminated PAMAM dendrimers modified with various percentages (0 60%) of poly(ethylene glycol) (PEG) strongly adsorbed on the titanium-based substrates. The resultant dendrimer films effectively inhibited the colonization of the Gramnegative bacteria Pseudomonas aeruginosa (strain PAO1) and, to a lesser extent, the Gram-positive bacteria Staphylococcus aureus (SA). The antibacterial activity of the films was maintained even after storage of the samples in PBS for up to 30 days. In addition, the dendrimer films had a low cytotoxicity to human bone mesenchymal stem cells (hMSCs) and did not alter the osteoblast gene expression promoted by the calcium phosphate coating. KEYWORDS: titanium, microarc oxidation, dendrimer, antibacterial coatings, mesenchcymal stem cell
1. INTRODUCTION Despite strict antiseptic operative procedures during implant surgery, implant-associated infection remains one of the most serious complications leading to destruction of local tissues, patient disability and morbidity, and even death.1 In the United States, the overall infection rates are approximately 7% for joint prostheses surgery and 1% for implantation of fracture-fixation devices,1,2 and the treatment of the infection costs $250 million annually.3 To reduce the infection, many methods have been investigated, including UV treatment,4,5 incorporation of silver nanoparticles,6 and coating of the implant with antimicrobial polymers,7,8 and local delivery of antibiotics, antimicrobial peptides, and inorganic antimicrobial powder.9 12 However, these methods suffer one or more of the following drawbacks: cytotoxicity and side effects,13,14 bacterial resistance,15 17 low antimicrobial efficiency,18 tedious preparation,7,12 and high cost.11 Furthermore, the most common antimicrobial agents to prevent and treat implant-associated infections are antibiotics.19 However, the rapid selection of pathogens to resist common antibiotics, especially in the hospital environment, has become a serious problem. Although Gram-positive bacteria, especially Staphylococus aureus, are the major cause of implant-associated infections,20 several drugs, such as Vancomycin and Linezolid,19 are currently available or under late development for treatment of such infections. In comparison, the development of new drugs against current drug-resistant, Gram-negative bacteria has r 2011 American Chemical Society
progressed more slowly for reasons including the following. First, antibiotics are more effectively shielded by the double cell membrane of the Gram-negative bacteria than the single membrane of the Gram-positive bacteria. Second, some Gram-negative bacteria, particularly Pseudomonas aeruginosa, possess powerful membrane pumps that expel a variety of antibiotics from the cell.21 This situation has called for the development of novel strategies to prevent implant-associated Gram-negative bacterial infections. In this work, we show that simple modification of three types of titanium-based materials with poly(amidoamine) (PAMAM) dendrimer derivatives results in bactericidal activity, particularly against Gram-negative bacteria P. aeruginosa, without apparent cytotoxicity to human bone mesenchymal stem cells (hMSCs). Titanium and titanium alloy are the most widely used materials for orthopedic implants because of their good biocompatibility, excellent corrosion resistance, and mechanical properties.22 It has been well-established that modification of titanium implants with calcium phosphate can greatly enhance the implant osseointegration. Many methods have been developed for coating of calcium phosphate onto titanium substrates, including microarc oxidation (MAO)23 25 and laser coating.26 Modification of these
Received: April 10, 2011 Accepted: July 11, 2011 Published: July 20, 2011 2885
dx.doi.org/10.1021/am2004398 | ACS Appl. Mater. Interfaces 2011, 3, 2885–2894
ACS Applied Materials & Interfaces
FORUM ARTICLE
systems with antimicrobial agents without affecting their osseointegration properties is of great interest. We previously reported that amino-terminated PAMAM dendrimers exhibited bactericidal activity particularly against Gram-negative bacteria Pseudomonas aeruginosa in solution.27,28 Although the mechanism for the antibacterial activity of PAMAM dendrimers has not been elucidated, we speculate that the aminoterminated dendrimers target and disrupt the Gram-negative bacterial membrane that are negatively charged.28 In general, bacteria are more difficult to develop resistance to antimicrobial agents targeting membranes than antibiotics targeting proteins. After modification with poly(ethylene glycol) (PEG), the generation 5 (G5) PAMAM dendrimers showed a low cytotoxicity to human corneal epithelial cells while maintaining a high bactericidal potency.27 Recently, PAMAM dendrimers have shown potential as topical antimicrobial agents and for local intravaginal application to pregnant women without affecting the fetus.29 Although PAMAM dendrimers are emerging as promising antimicrobial agents against multidrug resistant Gram-negative pathogens such as P. aeruginosa, their applications as antimicrobial coating on biomaterials have not been disclosed. Herein we report the coatings of (PEGylated) PAMAM dendrimers on titanium-based substrates. We then present the study of the stability of the dendrimer coatings, their bactericidal activity against Pseudomonas aeruginosa and Staphylococcus aureus, which are the leading causes of implant-associated Gram-negative and Gram-positive infections, respectively. Finally, we also report the biocompatibility of the coatings with human bone mesenchymal stem cells (hMSCs).
terminated PAMAM dendrimer with ethylenediamine initiator core (Dendritech, Inc., MI, USA), EG11NHS (NHS-m-dPEG, Mw = 685, Quanta Biodesign, Ohio, USA), prepacked Sephadex PD-10 columns (GE Healthcare, USA) were used in this study. All regents used for the MAO process were purchased from Guanghua Chemical Factory Co. Ltd. (Guangdong, China). The preparation of biphasic calcium phosphate/ Ti nanocomposite on titanium (BCP-Ti) (50%HA/50%Ti in the inner layer, and 80%HA/20%Ti in the outer layer) was described elsewhere.26 2.2. MAO Process. The preparation of the MAO-Ti sample was described in ref 30. Briefly, titanium plates were cleaned by treatment with 10% HF for 20s, and washed in ultrasonic bath successively with acetone, ethanol and deionized water, each for 20 min. The cleaned Ti plates were placed in an electrolysis cell and served as the anode, and a stainless steel as the cathode. The Ti plates and stainless steel were immersed into an aqueous solution of 82 mM EDTA as chelating agent, 60 mM Ca(OAc)2, and 20 mM Ca(H2PO4)2, pH 11 (adjusted with 2 mol/L NaOH solution). The MAO process was immediately started by applying a pulsed 450 V, 100 Hz DC field with a duty cycle of 30% to the specimens for 5 min. The samples were rinsed roughly with acetone, ethanol and deionized water, and dried by a stream of N2.
2.3. Synthesis and Characterization of PEGylated PAMAM Dendrimer. A solution of EG11NHS (100 mM in dichloromethane) was mixed with a G5 PAMAM solution (0.78 mM in methanol, the concentration correspond to ∼100 mM of NH2 groups due to the presence of ∼128 amino groups at the periphery) at various molar ratio (10%, 30% and 60% of EG11NHS vs NH2 groups on PAMAM), and stirred vigorously for 12 h. Results of the MALDI-TOF mass spectrometry showed the formation of ∼10%, ∼30% and ∼60% PEGylated PAMAM dendrimers (spectra shown in the Supporting Information, Figure 1S). The solvents were removed under vacuum and the products were purified with prepacked Sephadex PD-10 columns eluted with Millipore water. The product was dried in vacuum and characterized by matrix-assisted laser desorption ionization-time-of-flight (MALDITOF) mass spectrometry (MS) using a Voyager DE-STR MALDITOF mass spectrometer (Applied Biosystems), operated in the positive ion linear mode with an accelerating voltage ranging from 20 to 25 kV with delayed extraction. 2.4. Dendrimer Film Fabrication. Stock solutions of unmodified PAMAM dendrimer were prepared by dissolving the dendrimer in methanol to a concentration of 0.39 mM, and stock solutions of the PEGylated PAMAM dendrimer in 1:1 methanol/dichloromethane to 0.39 mM. Each MAO substrate was immersed into 400 μL of the dendrimer solution, and incubated with shaking for 2 h, rinsed thoroughly with ethanol and deionized water and dried with a flow of N2. The schematic diagram is shown in Scheme. 1. The substrates modified with PAMAM, 10, 30, and 60% PEGylated PAMAM dendrimer are abbreviated as TMP (Titanium-MAO-PAMAM), TMP-10%PEG, TMP-30% PEG, and TMP-60%PEG. For antimicrobial test of pristine titanium and the biphasic calcium phosphate/Ti nanocomposite (BCP-Ti) film on titanium, only the PAMAM dendrimer without PEG modification was deposited on these substrates. 2.5. X-ray Photoelectron Spectroscopy (XPS). XPS was performed with a PHI 5700 X-ray photoelectron spectrometer equipped
2. EXPERIMENTAL SECTION 2.1. Materials. Titanium substrates (grade 2, Baotai Co. Ltd. (Shanxi, China) in disk shape (r = 16 mm) for PCR experiment and in square shape (10 10 mm) for the other experiments), G5 amino-
Scheme 1. Schematic Diagram of the PEGylated PAMAM Dendrimer Film on MAO Substrate
Table 1. Validated Primer Sequences for Real-time PCR gene
ascension no.
forward primer
reverse primer
size (bp)
collagen I
NM_000088
CAGCCGCTTCACCTACAGC
TTTTGTATTCAATCACTGTCTTGCC
OPN Runx-2
NM_013227.2 NM_001024630.3
GCGAGGAGTTGAATGGTG AGAAGGCACAGACAGAAGCTTGA
CTTGTGGCTGTGGGTTTC AGGAATGCGCCCTAAATCACT
140 78
GAPDH
NM_002046
AGAAAAACCTGCCAAATATGATGAC
TGGGTGTCGCTGTTGAAGTC
126
2886
83
dx.doi.org/10.1021/am2004398 |ACS Appl. Mater. Interfaces 2011, 3, 2885–2894
ACS Applied Materials & Interfaces
FORUM ARTICLE
Table 2. Molecular Weight (Mw) of PEGylated PAMAM Dendrimers and the Grafting Ratios of EG11NHS onto PAMAM Mw(calculated)
Mw (measured)
grafting ratio (%)
10% PEG
36 377
37 400
11.3
30% PEG
50 742
49 000
29.2
60% PEG
72 658
65 000
51.1
Figure 2. N1s signal intensity of the films upon storage in PBS buffer for (a) 0, (b) 15, and (c) 30 days.
Figure 1. XPS narrow scans of the N1s and Ti2p regions of the indicated samples. with a monochromatic Al KR X-ray source (1486.7 eV) at a takeoff angle (TOA) of 45° from the film surfaces. 2.6. Stability Study. To estimate the stability of the polymer film, the samples were immersed into 2 mL of PBS for 30 days. Then the samples were washed with Millipore water, dried, and subjected to XPS to provide the narrow scans of N1s and Ti2p signals. 2.7. Antimicrobial Assay. 2.7.1. Bacterial Culture. The P. aeruginosa (PAO1) expressing green fluorescent protein (GFP) was provided by Dr. Alison M. Mcdermott (College of Optometry, University of Houston, Houston, TX, USA). Staphylococcus aureus (SA, strain ATCC 29213) was purchased from VWR International, LLC. Single colony of GFP-PAO1 was inoculated in 5 mL of LB with 300 μg/mL carbenicillin overnight at 37 °C while single colony of SA incubated in 5 mL of LB overnight at 37 °C. After that, 1 mL of the GFP-PAO1 or SA suspension was inoculated in 50 mL of fresh LB with or without 300 μg/mL carbenicillin, respectively. The suspension was incubated for 5 h with shaking (250 rpm) at 37 °C to achieve midlog phase growth. Then the bacteria were resuspened to PB buffer (PB, Sigma, USA; 8.2 mM Na2HPO4, 1.8 mM KH2PO4, pH 7.4) and the optical density was adjusted to about 0.26 at 635 nm (approximately 5.0 107 cfu/mL). 2.7.2. Bacterial Adhesion. Prior to seeding, the samples were sterilized by 75% ethanol for 0.5 h, placed into a 24-well culture plate and washed twice with PB buffer. Then 500 μL of bacterial suspension (OD = 0.26) was added to each sample to fully cover the surface of substrate. The bacteria were cultured with shaking at 37 °C (150 rpm) for various durations.
Figure 3. Ti2p signal intensity of the films upon storage in PBS buffer for (a) 0, (b) 15, and (c) 30 days. 2.7.3. Viability Tests. 2.7.3.1. Staining-Based Method. After incubation in the culture of GFP-PAO1 for 3 h, the MAO substrates were taken out and washed gently with PB buffer. One μL of 15 μM propidium iodide (PI) was placed on the substrate and the substrate was covered by a cover slide. Fluorescence microscopy imaging was performed on randomly chosen locations using a fluorescence microscope (eclipse 80i, Nikon). All PAO1 bacteria expressing GFP fluoresced green while bacteria with damaged membranes fluoresced red. 2.7.3.2. Serial Dilution and Plating Method. After incubation for 0.5, 1, 2, and 3 h, for each sample 10 μL of the PAO1 or SA bacterial suspension was taken while shaking to evaluate the viability of bacteria in the suspension with the serial dilution method using agar plates. To evaluate the viability of PAO1 and SA bacteria on the surface, after incubation for 3 h, the samples were washed gently and then immersed in 1 mL of sterile PB buffer in an ultrasonic bath for 10 min to detach the 2887
dx.doi.org/10.1021/am2004398 |ACS Appl. Mater. Interfaces 2011, 3, 2885–2894
ACS Applied Materials & Interfaces
FORUM ARTICLE
Figure 4. 3D fluorescence images of the indicated surfaces after 3 h of incubation in a suspension of PA01 (5.0 107 cfu/mL) expressing GFP in PBS buffer containing PI as the viability indicator. The green channels indicate all the bacteria on the surface and the red channels indicate those were killed (membrane-compromised). adhered bacteria. Then, viable bacteria were evaluated with the serial dilution method by using agar plates. To evaluate the stability of the antibacterial activity of the film, after incubating the samples in PBS for 30 days, we took out the samples and used PAO1 bacteria to test the antibacterial activity of the samples after incubation for 0.5, 1, 2, and 3 h as above. For the pristine titanium and BCP-Ti substrates, the same method was applied to test the viability of PAO1 bacteria in the suspension after 0.5 h and on the surface after 3 h. 2.8. Cell Assay. The influence of the PEGylated PAMAM dendrimer films to cell adhesion, proliferation, and differentiation was tested with the human bone mesenchymal stem cells (hMSCs, kindly provided by Dr. Yunzhi Yang at the Department of Restorative Dentistry and Biomaterials, University of Texas Health Science Center at Houston, Texas, USA) as the following. 2.8.1. Cell Culture and Seeding. HMSCs were cultured in low-glucose Dulbecco’s modified Eagle’s medium (L-DMEM) (Hyclone, Logan, Utah) containing 10% fetal bovine serum (FBS) and cultured in a 5% CO2 atmosphere at 37 °C. Medium was replaced every third day. The adherent cells
were allowed to reach about 80% confluence. Cells were passaged in culture and passage 3 5 (P3 P5) cells were used for the experiments. All samples used for cell test were sterilized with 75% ethanol for 2 h. After sterilization, the samples (square-shaped, 10 10 mm2 for Live/ Dead and MTT assay, and disk-shaped, r = 16 mm for RT-PCR assay) were placed individually into the 24-well or 6-well plates, and the human bone mesenchymal stem cells (hMSCs) were added directly to each sample (5000 cells in 20 μL media suspension per sample for Live/Dead and MTT assay, and 2.5 105 cells in 1000 μL media suspension per sample for RT-PCR assay). In the RT-PCR experiment, the cell culture plate was used as the positive control with the same amount of cells. After 2 h incubation, complete medium (L-DMEM containing 10% FBS) was slowly added to each well to cover the surface of the samples. They were cultured for either a few hours or days according to the different regimes and the culture medium was changed every 2 days. 2.8.2. Live/Dead Assay. After incubating the samples with cells at 37° for 6 h, the substrates were washed with PBS carefully to remove the unattached cells and treated with a Live/Dead assay kit (Invitrogen, Singapore) following the manufacturer’s instruction. Then the samples 2888
dx.doi.org/10.1021/am2004398 |ACS Appl. Mater. Interfaces 2011, 3, 2885–2894
ACS Applied Materials & Interfaces
FORUM ARTICLE
2
Figure 5. (a) P. aeruginosa colony counts (cfu/cm ) on various substrate surfaces after 3 h incubation in PBS solution at a concentration of 5.0 107 cfu/mL; (b) P. aeruginosa remained in PBS solution on various surfaces for the given time points. (n = 3) (***) denotes significant differences (p < 0.001) compared with MAO substrate.
were investigated with a fluorescence microscope (Axioskop 40, Zeiss, Germany). 2.8.3. MTT Assay. After being cultured for 6 h, 4 days, and 7 days, the biocompatibility of the materials was evaluated with MTT [3- (4,5dimethylthiazol-2-yl) - 2, 5- diphenyl tetrazolium bromide, Sigma] assay. Briefly, at indicated time points, the samples were washed three times with PBS. Then, 750 μL of complete medium with 75 μL of MTT (5 mg/mL in PBS) was added to each disk. After incubation for 4 h at 37 °C, the MTT solution was removed and the formazan crystals were dissolved in 400 μL of DMSO, and the plates were shaken for 20 min. The optical density (OD) value of the dissolved solute was measured with an ELISA plate reader (Varioskan Flash 3001, Thermo, Finland) at 490 nm wavelength. 2.8.4. Real Time Quantitative Reverse Transcription-Polymerase Chain Reaction (RT-PCR). To prepare the RT-PCR samples, after culturing the hMSCs on the samples for 3 days, Osteogenic medium (L-DMEM containing 10% FBS, 10 mM sodium β-glycerophosphate, 0.05 mM vitamin C, and 100 mM dexamethasone) was added into 6-well plate to induce the MSCs to Osteoblasts for additional 10 days and the osteogenic medium was changed every 2 days. Total RNA was isolated following the TRIzol protocol (Invitrogen). Oligo (dT) was used as a reverse transcription primer to reverse-transcribe the RNA samples for the first strand cDNA synthesis (RevertAid M-MuLV, Fermentas). The Q-PCR for Collagen I (Col I), osteopontin (OPN), and runt-related transcription factor-2 (Runx-2) was then performed with a Chromo4 realtime PCR detection system (Biorad) using a real-time PCR kit (SYBR
Figure 6. (a) S. Aureus colony counts (cfu/cm2) on various substrate surface after 3 h incubation in PBS solution at a concentration of 5.0 107 cfu/mL; (b) S. Aureus remained in PBS solution on various surfaces for the given time points. (n = 3) (***) denotes significant differences (p < 0.001) compared with MAO substrate. Premix EXII, TaKaRa). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the confidential reference. The primer sequences are listed in Table 1 and the gene expressions were quantified by 2 ΔC. 2.9. Statistics. The contact angle test, film stability test, antimicrobial assay, and cell assay were repeated at least three times and the results were expressed as means ( standard deviations. Statistical significance was calculated using the SPSS 17.0 statistical software. Statistical significance was defined as p < 0.05.
3. RESULTS AND DISCUSSION 3.1. Synthesis and Characterization of PEGylated PAMAM Dendrimers. The MALDI-MS results show that the actual Mw of
the commercial G5 PAMAM dendrimer was 27700, lower than the theoretical Mw of 28824.81. Hence, the average number of peripheral amino groups in the commercial G5 PAMAM used in this study was about 120, rather than 128. It is well-known that the high generation PAMAM dendrimers contain deletion defects, which are introduced during their divergent synthesis.31,32 The degree of PEGylation on PAMAM was quantified by MALDI-MS and the data are depicted in Table 2. The result shows that the graft density of PEG chains were close to the molar ratio of the PEGylation agent and the amino groups on the dendrimer (EG11-NHS/NH2). 3.2. Surface Modification and Characterization. The microarc oxidation (MAO) process was used to incorporate apatite on the titanium substrates.23 25 The TiO2/calcium phosphate layer formed by the MAO process has a barrier type structure 2889
dx.doi.org/10.1021/am2004398 |ACS Appl. Mater. Interfaces 2011, 3, 2885–2894
ACS Applied Materials & Interfaces
FORUM ARTICLE
Figure 7. P. aeruginosa remained in PBS solution for the given time points culturing the indicated substrates that were previously stored in PBS for 30 days. (n = 3).
inside and a porous structure outside. This unique structure greatly promotes the inward growth and interconnection between implant and the osseous tissue.33,34 The characterization of titanium substrates modified with the MAO process in electrolytes containing Ca(OAc)2, and Ca(H2PO4) has been previously described.30 The SEM, XRD, and XPS characterization of the samples prepared for this study are shown in the Supporting Information (Figure 2S). The oxide film featured microporous structures, and the phase of the MAO titanium surface is composed of apatite, anatase, rutile, titanium, and perovskite. The XPS result showed that the compositions of the MAO coating were mainly Ti, O, Ca, P, and C. It was reported that such films possessed excellent biocompatibility and bioactivity.30,33,35,36 No apparent difference was found in the SEM images of the MAO samples before and after modification with PEGylated PAMAM dendrimer. The immobilization of PEGylated PAMAM dendrimer film onto the MAO substrates was indicated by the strong and broad N1s peak at 400 eV (Figure 1 a), corresponding to the nitrogen atoms in PAMAM.37 The N1s signal intensity decreased with increasing density of PEG chains on the dendrimers. The highresolution spectra of Ti2p (Figure 1 b) showed that the Ti signal intensity was lower in the TMP-10%PEG and TMP-30%PEG samples than that in the TMP and TMP-60%PEG samples. The thickness of the dendrimer films was estimated by XPS (see the Supporting Information, Table 1S). Note that the film thickness derived from XPS is only a rough estimate, subjected to the invalid assumptions that the film is uniform and the surface is flat, although the “magic take-off angle” of 45° was used which might reduce the average error to 10%.38 In the TMP samples, the thickness of PAMAM coating was about 1.96 nm, similar to the reported values (1.60 nm) for monolayers of PAMAM deposited on different substrates.37 For the TMP-10%PEG and TMP-30% PEG films, the decrease in N1s and Ti2p signal intensity compared to those of TMP group may be caused by the increase of the attenuation of the photoelectrons by the thicker PEGPAMAM dendrimer films (see Table 1S in the Supporting Information). As compared to the TMP-30%PEG films, both the lower N/Ti ratio and the film thickness for the TMP-60% PEG films indicated a lower density of the dendrimer with a relatively high degree (60%) of PEGylation. This result is attributed to the lower number of amino groups hence positive charges39 on TMP-60%PEG, thus decreasing its interactions with the negatively charged TiO2 surfaces.40 Other types of
Figure 8. Antimicrobial activity of the PAMAM dendrimer film on different substrates: (a) the antimicrobial activity to PA01 in the PBS solution after 0.5 h; (b) the antimicrobial activity to PAO1 on the surface after 3 h. (n = 3) (**) denotes significant differences (p < 0.01) compared with the substrate without PAMAM film; (***) denotes significant differences (p < 0.001) compared with the substrate without PAMAM film.
binding between PAMAM and the Ti substrates, e.g., the complexation of amino groups with Ti4+, may also take place. The low water contact angles of 25 35° (see the Supporting Information, Figure 3S) for all dendrimer-modified films were consistent with the hydrophilic nature of the PAMAM dendrimers and the PEG chains. The stability of the films for up to 30 days in PBS buffer was monitored by the N1s and Ti2p signal intensities. The results are summarized in Figures 2 and 3, showing a decrease of the N1s signal intensity and an increase of the Ti2p signal intensity. This result indicates the slow desorption/degradation of the unmodified PAMAM dendrimer. As compared to the films of the unmodified PAMAM, there were a larger increase of the Ti2p signals for the TMP-10%PEG and TMP-30%PEG films and a small decrease of the N1s intensities. Also, the intensities of these films after 30 days were similar to that of the unmodified PAMAM films. This result is probably due to the faster degradation of the OEG chains than the PAMAM dendrimers possibly via autoxidation41 which could be promoted by the titanium species. Among the four films, the one with the highest degree of PEGylation (TMP-60%PEG) gave the largest decrease in the N1s signal and increase in the Ti2p signal, consistent with the aforementioned weaker interaction of the 60% PEGylated dendrimers with the Ti substrates. 3.3. Antimicrobial Assay. The antibacterial activity of the coating of PAMAM derivatives on Ti-MAO substrates against P. aeruginosa was evaluated by fluorescence microscopy using the strain PAO1 expressing green fluorescent protein (GFP-PA) and propidium iodide (PI) as the viability indicator (Figure 4), as well as by plating of the bacteria remained in the solution (Figure 5). After incubation of the samples with a suspension of PAO1 for 2890
dx.doi.org/10.1021/am2004398 |ACS Appl. Mater. Interfaces 2011, 3, 2885–2894
ACS Applied Materials & Interfaces
FORUM ARTICLE
Figure 9. Fluorescence photographs of cell proliferation on various samples after 6 h.
3 h, the fluorescence microscopy images show that the bacteria on the TMP and the TMP-10%PEG samples were mostly killed. Slight increase in survival of the bacteria was observed on the TMP-30%PEG and more on the TMP-60%PEG samples. Similarly, the bacteria remained in the solution followed the same trend (Figure 5). Relative to the control using a MAO substrate without modification, the number of viable bacteria remained in the solution after incubation with TMP, TMP-10% PEG and TMP-30%PEG samples for 3 h was decreased to 28, 24, and 38%, respectively (Figure 5a). Figure 5b plots the viability vs time for the bacteria in the solution in the presence of the PAMAM-coated samples. After incubation for 0.5 h, the bacterial concentration in the solutions immersing the TMP, TMP-10% PEG, and TMP-30%PEG samples decreased to 43, 43, and 58% relative to the control (MAO substrate). Prolonging the incubation time to 3 h further decreased viable bacteria in these three samples to 30, 26, and 32%, respectively, relative to the control (MAO substrate). The apparently lower bactericidal activity shown by the plating method (Figure 5) as compared to the fluorescent imaging (Figure 4) could be attributed to the lower coverage of PAMAM dendrimers on the backside of
the substrates where more adherent bacteria remained viable. Although the detail mechanism for the bactericidal action on the PAMAM dendrimer is not clear, the process may be initiated by electrostatic binding of the negatively charged bacteria to the polycationic dendrimer.28 This initial process may be followed by disruption of the cytoplasmic membrane of the bacteria.28 The low antimicrobial activity on the films of the 60% PEGylated PAMAM (TMP-60%PEG) could be due to the large reduction of the number and accessibility of the amino groups on PAMAM. The coating of PAMAM derivatives on Ti-MAO substrates was also tested for inhibition of the colonization of Staphylococcus aureus (SA). As shown in Figure 6, although the dendrimer film could not kill the bacteria in solution, substantial amounts of bacteria adhered onto the film were killed. Thus, after cultured for 3 h, the viability of SA on TMP and TMP-10%PEG samples decreased to 24 and 42% of the control (MAO substrate), respectively. Higher degrees of PEGylation on the PAMAM dendrimer diminished the bactericidal activity against SA as shown by the results obtained with TMP-30%PEG and TMP60%PEG comparing to the control (MAO substrate). Overall, at 2891
dx.doi.org/10.1021/am2004398 |ACS Appl. Mater. Interfaces 2011, 3, 2885–2894
ACS Applied Materials & Interfaces
FORUM ARTICLE
Figure 10. Cell viability after 6 h, 4 days, and 7 days of culture on different samples. (n = 3).
a low PEGylation (
