Stimulation of Osteogenic Activity in Human Osteoblast Cells by Edible

Osteoblasts, the bone-forming cells that originate from mesenchymal stem cells, play a crucial role in creating and maintaining skeletal architecture...
0 downloads 0 Views 3MB Size
Download PDF
Article pubs.acs.org/JAFC

Stimulation of Osteogenic Activity in Human Osteoblast Cells by Edible Uraria crinita Yi-Wen Mao,†,‡ Rong-Dih Lin,§ Hsiao-Chiao Hung,‡ and Mei-Hsien Lee*,‡,∥,⊥ †

School of Pharmacy, College of Pharmacy, Taipei Medical University, Taipei 110, Taiwan Graduate Institute of Pharmacognosy, College of Pharmacy, Taipei Medical University, Taipei 110, Taiwan § Department of Internal Medicine, Heping Branch, Taipei City Hospital, Taipei 110, Taiwan ∥ Center for Reproductive Medicine & Sciences, Taipei Medical University Hospital, Taipei 110, Taiwan ⊥ Ph.D. Program for the Clinical Drug Discovery from Botanical Herbs, Taipei 110, Taiwan ‡

S Supporting Information *

ABSTRACT: Uraria crinita is an edible herb used as a natural food for childhood skeletal dysplasia. Ethyl acetate, n-butanol, and aqueous fractions of a 95% ethanol crude extract of U. crinita were obtained and the active ingredients isolated and purified using a bioguided method. In this manner, we isolated and identified a new active flavone glycoside, apigenin 6-C-β-D-apiofuranosyl(1→2)-α-D-xylopyranoside (3) and 10 known components with stimulatory activity on human osteoblast cells. The new compound 3 at 100 μM significantly increased alkaline phosphatase activity (114.10 ± 4.41%), mineralization (150.10 ± 0.80%), as well as osteopontin (1.39 ± 0.01-fold), bone morphogenetic protein-2 (BMP-2, 1.30 ± 0.04-fold), and runt-related transcription factor 2 (Runx2, 1.43 ± 0.10-fold) mRNA expression through the activation of the BMP-2/Runx2 pathway. Two other components, dalbergioidin (1) and byzantionoside B (9), displayed similar effects. These results show that U. crinita and its active compounds may have the potential to stimulate bone formation and regeneration. KEYWORDS: Uraria crinita, human osteoblast cells, alkaline phosphatase, mineralization, apigenin 6-C-β-D-apiofuranosyl(1→2)-α-D-xylopyranoside, osteopontin, BMP-2/Runx2 pathway

■

INTRODUCTION Uraria crinita (L.) Desv. ex DC. (Fabaceae), an edible herb used in traditional medicine, is widely distributed throughout India, Thailand, Indonesia, southern China, and Taiwan. This herb has been reported to repress the formation of stressinduced ulcers1 and to have antioxidant activity,2 and its roots are used to treat chills, edema, and stomachache through effects that are possibly mediated by its anti-inflammatory activity.3 In Taiwan, U. crinita is drunk as a tea that, similar to ginseng, is fragrant, sweet, and thirst-quenching, and it is therefore known as “Taiwanese ginseng.” In traditional Chinese medicine, U. crinita roots are used as dietary supplements for treating childhood skeletal dysplasia as well as for sports injuries, stress fractures, sprains, and strains,4 and its extracts are rich in β-sitosterol, flavonoids, butulin, stearic acid, and sucrose.4,5 Osteoblasts, the bone-forming cells that originate from mesenchymal stem cells, play a crucial role in creating and maintaining skeletal architecture. Bone formation involves a complex series of events that include the proliferation and differentiation of osteoblasts, and ultimately results in mineralization of the extracellular matrix (ECM).6 Specific genes are sequentially expressed or repressed during each stage of osteoblast development; for example, histone 4 expression is a marker of proliferation, alkaline phosphatase (ALP) expression is a marker of differentiation,7 and osteopontin (OPN) expression is a marker of mineralization.8 Bone morphogenetic proteins (BMPs) are members of the transforming growth factor (TGF)-β family that activate SMAD proteins and other signaling pathways to stimulate the expression of a number of regulatory genes, © 2014 American Chemical Society

including runt-related transcription factor 2 (Runx2). Both BMP growth factors and Runx2 transcription factors play essential roles in osteoblast differentiation and subsequent bone matrix mineralization.9,10 Bone formation is necessary for the proper growth of bones in infants and children, prevention of bone mass loss in climacteric women, and healing and remodeling of bone fractures. Thus, there is a clinical need for nutritional and pharmacological agents that prevent bone loss and increase bone formation to support human health. Primary osteoblast cell cultures are widely used as in vitro models to investigate the effects of new agents on osteoblast differentiation, matrix mineralization, and new bone formation. A number of factors influence the expression of the osteoblastic phenotype in cell culture.11 For example, osteogenic supplements such as glucocorticoids, ascorbic acid, and β-glycerophosphate have been demonstrated to induce matrix mineralization in bone cell cultures and are extensively used to investigate agents that regulate bone formation in vitro.6 Previous studies have revealed that many traditional Chinese herbal medicines affect bone formation, including Puerariae radix,12 Drynariae rhizome,13 and Epimedium pubescens.14 However, there are no reports of the effects of U. crinita on osteoblasts. Therefore, this study was performed to determine whether U. crinita root extracts and their Received: Revised: Accepted: Published: 5581

March 12, 2014 May 1, 2014 May 2, 2014 May 2, 2014 dx.doi.org/10.1021/jf5012177 | J. Agric. Food Chem. 2014, 62, 5581−5588

Journal of Agricultural and Food Chemistry

Article

Table 1. 1H and 13C NMR Data of Compound 3 (DMSO-d6, 500 and 125 MHz) position 2 3 4 5 6

δH (J in Hz) 6.75, s

7 8 9 10

6.51, s

1′ 2′, 6′ 3′, 5′ 4′

7.92, d (8.8) 6.91, d (8.8)

δC

position

163.5 102.8 181.8 161.2 108.8

1″ 2″ 3″ 4″ 5″

163.5 94.0 156.4 103.2

1‴ 2‴ 3‴ 4‴

121.1

5‴

128.5 116.0 161.2

5-OH

δH (J in Hz) 4.55, 4.27, 3.54, 3.74, 3.51, 3.77, 5.15, 3.58,

br s br s m m m m br s m

2.52, m 3.08, d (9.3) 2.99, d (11.0) 3.18, d (11.0) 13.50, br s

Extraction and Isolation. Fresh roots (14.7 kg) of U. crinita were extracted three times with ethanol (EtOH, 95% v/v), and the filtrate was evaporated and dried under a vacuum. The dried extract (601.4 g) was suspended in H2O and successively partitioned with ethyl acetate (EtOAc) and n-butanol (n-BuOH) to yield 32.0 and 133.9 g of extract, respectively. The EtOAc extract was subjected to Sephadex LH-20 column chromatography (Amersham Pharmacia Biotech, Uppsala, Sweden) and eluted with 95% EtOH to yield 9 fractions (UCE-1−9). Fraction UCE-3 was further separated by Sephadex LH-20 column chromatography and eluted with a MeOH/H2O gradient (40−100%) to yield 17 fractions (UCE-3-1−17). Fraction UCE-3-7 was fractionated by MCI CHP-20 column chromatography (Supelco, Bellefonte, PA, USA) with an H2O-MeOH gradient to yield 14 fractions (UCE-3-7-1−14). Compound 2 (98.1 mg) was obtained from the UCE-3-7-4 fraction after recrystallization from MeOH/H2O. Fraction UCE-4 was further separated by Sephadex LH-20 column chromatography and eluted with a MeOH/ H2O gradient (50−100%) to yield 17 fractions (UCE-4-1−17). Fractions UCE-4-3 and UCE-4-10 were fractionated on an MCI CHP-20 column with a MeOH/H2O gradient (30−100%) to yield 8 (UCE-4-3-1−8) and 11 (UCE-4-10-1−11) fractions, respectively. Compound 11 (12.0 mg) was obtained from the UCE-4-3-2 fraction after purification on a semipreparative C-18 reverse-phase HPLC column (Biotic Chemical Co., Taipei, Taiwan) with 10% MeOH as the eluent. Compound 4 (6.9 mg) was obtained from the UCE-4-10-2 fraction after purification on a semipreparative C-18 reversed-phase HPLC column with 25% acetonitrile as the eluent. Fraction UCE-5 was separated by MCI CHP-20 column chromatography with an H2O−MeOH gradient to yield 24 fractions (UCE-5-1−24). Fractions UCE-5-15 and UCE-5-16 were subjected to Sephadex LH-20 column chromatography and eluted with 60% MeOH to yield 6 (UCE-5-15-1−6) and 10 (UCE-5-16-1−10) fractions, respectively. Compounds 3 (12.2 mg) and 1 (184.5 mg) were obtained from the UCE-5-15-1 and UCE-5-16-9 fractions, respectively, after purification on a semipreparative C-18 reversed-phase HPLC column with 55% MeOH as the eluent. The n-BuOH extract was subjected to Diaion HP-20 column chromatography (Mitsubishi Chemical Industries, Tokyo, Japan) and eluted with an H2O−MeOH gradient to yield 6 fractions (UCB-1−6). Fractions UCB-3, UCB-4, and UCB-5 were further separated by Sephadex LH-20 column chromatography and eluted with 95% EtOH to yield 6 (UCB-3-1−6), 9 (UCB-4-1−9), and 6 (UCB-5-1−6) fractions, respectively. Fractions UCB-3-3 and UCB-5-2 were separated by MCI CHP-20 column chromatography with an H2O−MeOH gradient to yield 6 (UCB-3-3-1−6) and 8 (UCB-5-2-1−8) fractions, respectively. Compounds 7 (38.3 mg) and 8 (15.3 mg) were obtained from the UCB-3-3-2 fraction. Compounds 5 (58.6 mg) and 6 (7.6 mg) were obtained from the UCB-3-3-3 and UCB-5-2-1 fractions, respectively, after purification on a semipreparative C-18 reversed-phase HPLC column with 20% MeOH as the eluent. Fractions UCB-4-3 and UCB-4-4 were separated on MCI CHP-20 columns and eluted with MeOH/H2O gradients (60−100% and 20−100%, respectively) to yield 4 (UCB-4-31−4) and 9 (UCB-4-4-1−9) fractions, respectively. Compound 9 (38.5 mg) was obtained from the UCB-4-3-3 fraction after purification on a semipreparative C-18 reversed-phase HPLC column with 20% MeOH as the eluent. Compound 10 (13.5 mg) was obtained from the UCB-4-4-3 fraction after purification on a semipreparative C-18 reversedphase HPLC column with 40% MeOH as the eluent. Acid Hydrolysis of Compound 3. Compound 3 (1 mg) was dissolved in 6 N HCl and hydrolyzed at 80 °C for 6 h. The mixture was cooled, the acid was evaporated, and the remaining mixture was resuspended in double-distilled H2O and filtered through a Millipore Millex-GX nylon membrane (EMD Millipore, Billerica, MA, USA).15 Monosaccharides of 3 and polysaccharide hydrolysates were separated

δC 72.1 72.6 75.1 69.4 70.1 109.1 75.9 79.0 73.6 64.5

active constituents have osteogenic effects on human osteoblast (HOb) cells.

■

MATERIALS AND METHODS

Plant Material. Uraria crinita roots were collected from the Mingjian Township Farmers’ Association, Nantou, Taiwan and identified by Dr. Chao-Lin Kuo, School of Chinese Pharmaceutical Sciences and Chinese Medicine Resources, China Medical University, Taichung, Taiwan. A voucher specimen (M-343) was deposited at the Graduate Institute of Pharmacognosy, Taipei Medical University, Taipei, Taiwan. Reagents and Chemicals. Dimethyl sulfoxide (DMSO), MTT, Triton X-100, p-nitrophenyl phosphate disodium, alizarin red-S, cetylpyridinium chloride monohydrate, ascorbic acid, and β-glycerophosphate disodium salt hydrate were purchased from Sigma-Aldrich (St. Louis, MO, USA). Phosphate-buffered saline (PBS) and trypsin were purchased from Gibco (Burlington, Canada). Osteoblast growth medium (OGM) and osteoblast differentiation medium (ODM) were purchased from Cell Applications (San Diego, CA, USA). A bicinchoninic acid (BCA) protein assay kit was purchased from Thermo Scientific (Rockford, IL, USA), 4-nitrophenyl phosphate disodium salt hexahydrate was obtained from Alfa Aesar (Ward Hill, MA, USA), High Pure RNA Isolation Kit and Universal Probe Library (UPL) probes were acquired from Roche (Mannheim, Germany), SuperScript II reverse transcriptase was obtained from Invitrogen (Burlington, Canada), and SafeView nucleic acid stain was purchased from NBS Biologicals (Huntingdon, UK). All chemicals and reagents were high-grade commercial products. General Experimental Procedures. Optical rotations were measured on a Jasco P-1020 digital polarimeter (Tokyo, Japan). Ultraviolet spectra were recorded on a Hitachi U-2800 UV/vis spectrometer (Tokyo, Japan). 1D- and 2D-nuclear magnetic resonance (NMR) spectra were measured with a Bruker AM-500 spectrometer (Rheinstetten, Germany) using DMSO-d6, methanol (MeOH)-d4, and D2O solutions. High-resolution eletrospray ionization mass spectroscopy (HRESI-MS) and ESI-MS analyses were performed using VG Platform Electrospray ESI/MS (Altrincham, Cheshire, UK).

Table 2. Primers and Probe Combinations Used for Q-RT-PCR genes

forward primer

reverse primer

accession number

probe number

OPN BMP-2 Runx2 GAPDH

GGGCTTGGTTGTCAGCAG CGGACTGCGGTCTCCTAA CAGTGACACCATGTCAGCAA AGCCACATCGCTCAGACAC

TGCAATTCTCATGGTAGTGAGTTT GGAAGCAGCAACGCTAGAAG GCTCACGTCGCTCATTTTG GCCCAATACGACCAAATCC

NM_001040058.1 NM_001200.2 NM_001024630.3 NM_002046.3

63 49 41 60

5582

dx.doi.org/10.1021/jf5012177 | J. Agric. Food Chem. 2014, 62, 5581−5588

Journal of Agricultural and Food Chemistry

Article

on a high-performance anion-exchange chromatographic (HPAEC) system (Dionex, Sunnyvale, CA, USA) using an anion-exchange column (Carbopac PA-10, 4.6 × 250 mm; Dionex, Sunnyvale, CA, USA). Monosaccharides were analyzed using isocratic elution with an 18 mM NaOH solution at ambient temperature. Apigenin 6-C-β-D-Apiofuranosyl(1→2)-α-D-xylopyranoside, 3. Yellow solid; [α]22D +21 (c 0.5, MeOH). UV (MeOH) λmax (log ε): 272 (4.36), 329 (4.35) nm; 1H NMR (DMSO-d6, 500 MHz); and 13C NMR (DMSO-d6, 125 MHz); see Table 1. HRESI-MS m/z 535.1459 [M + H]+ (calcd for C25H27O13, 535.1452). Cell Culture. HOb primary cells were derived from a normal femoral bone of a 63-year-old Caucasian female and obtained from Cell Applications (San Diego, CA, USA). HOb cells attach and spread on tissue culture surfaces, proliferate in OGM, and express differentiation and mineralization markers when cultured in ODM containing ascorbic acid and β-glycerophosphate at 37 °C in a 5% CO2 humidified atmosphere. The growth medium was changed every other day. To maintain exponential growth, cells were subcultured every 7 days. HOb cells were used for all assays. Cell Viability Assay. HOb cell viability was determined using the MTT assay as described elsewhere.16 In brief, HOb cells were seeded in 96-well plates at a density of 4000 cells/well. After 24 h, the culture medium was replaced with fresh medium containing the test extracts or compounds. After 72 h, the incubation medium was removed, and the MTT reagent was added for 4 h. The MTT reagent was then replaced with 100 μL of DMSO, and the wells were thoroughly mixed to dissolve the dark-blue crystals. The absorbance at 600 nm was recorded using an enzyme-linked immunosorbent assay reader. Alkaline Phosphatase (ALP) Assay. ALP activity in HOb cells was measured by a colorimetric assay using p-nitrophenyl phosphate as the substrate.17 HOb cells were seeded in 96-well plates at a density of 4000 cells/well, and after 24 h, the culture medium was replaced with fresh ODM containing the test extracts or compounds. After 72 h, the incubation medium was discarded, and cells were rinsed twice with cold PBS and then lysed by adding lysis buffer (PBS containing 0.1% Triton X-100). The protein concentration in the supernatant was determined by a BCA assay. Supernatants were incubated with the BCA reagent for 1 h at 37 °C. The reaction was stopped by the addition of 1 M NaOH, and the absorbance was measured at 560 nm. ALP activity in the supernatants was assayed by incubation for 1 h at 37 °C in 0.1 M NaHCO3−Na2CO3 buffer (pH 10) containing 0.1% Triton X-100, 2 mM MgSO4, and 6 mM p-nitrophenyl phosphate. The reaction was stopped by the addition of 1 M NaOH, and the absorbance was measured at 405 nm. ALP activity was normalized to the protein concentration in each supernatant. Mineralized Matrix Formation Assay. HOb cell mineralization was measured by alizarin red-S staining of calcium.18 HOb cells were seeded in 24-well plates at a density of 7 × 104 cells/well, and after 3 days, the culture medium was replaced with mineralizing medium (ODM supplemented with 50 μg/mL ascorbic acid and 10 mM β-glycerophosphate) containing the test extracts or compounds. Cells were incubated for 12 days and then fixed in 75% EtOH. Calcium deposits were stained for 15 min at room temperature with an alizarin red-S solution (40 mM, pH 4.2). The bound stain was eluted with a solution of 10% (w/v) cetylpyridinium chloride in 10 mM sodium phosphate (pH 7.0), and the absorbance was measured at 550 nm. RNA Extraction and Q-RT-PCR. HOb cells were seeded in 6 cm dishes at a density of 7 × 105 cells/dish, and after 24 h, the culture medium was replaced with fresh ODM containing the test extracts. After 24 h, total RNA was extracted with High Pure RNA Isolation Kit and reverse-transcribed with SuperScript II reverse transcriptase according to the manufacturer’s instructions. Q-RT-PCR was used to measure OPN, Runx2, and BMP-2 mRNA expression. Specific primers were designed using the Universal Probe Library Assay Design Center (www.roche-applied-science.com) and the suggested Universal Probe Library (UPL) probes. The detailed sequences of primers and probes are given in Table 2. All reactions were performed in triplicate using a Roche LightCycler 480 detection system using the 2−ΔΔCt method. Runx2, BMP-2, and OPN mRNA expression results were

Figure 1. Effects of U. crinita extract (UC) and subfractions on ALP activity and mineralization in HOb cells. (A) HOb cells were seeded in 96-well plates and treated with 100 μg/mL of the indicated extracts for 72 h. ALP activity was measured using a colorimetric assay with p-nitrophenyl phosphate as the substrate. (B) HOb cells were plated in 24-well plates and treated with 100 μg/mL of the indicated extracts for 12 days. Mineralized nodule formation was assessed by alizarin red staining. (C) Quantitative analysis of the extent of mineralization. Daidzein (100 μM) was used as the positive control. Data are the presented as the mean ± SD (n = 3). * p < 0.05 and ** p < 0.01 compared to control cells. 5583

dx.doi.org/10.1021/jf5012177 | J. Agric. Food Chem. 2014, 62, 5581−5588

Journal of Agricultural and Food Chemistry

Article

Figure 2. Schematic representation of the chemical structures of the isolated constituents from U. crinita and key HMBC correlations (H → C) for compound 3. normalized against GAPDH expression and expressed as relative expression compared with that of the controls. Statistical Analysis. Data are expressed as the mean ± standard deviation (SD). Significant differences (p < 0.05 and p < 0.01) among the corresponding mean values were determined using one-way analysis of variance (ANOVA) followed by the Student−Newman− Keuls test. Probability values of p < 0.05 and p < 0.01 were considered statistically significant and extremely significant, respectively.

the mineralized matrix in HOb cells; therefore, we purified their active compounds in subsequent studies. Bioguided Isolation and Identification of Active Compounds from U. crinita. For purification of active compounds, the active EtOAc and n-BuOH fractions were subjected to column chromatography and high-performance lipid chromatography (HPLC). One new compound, 3, and 10 known compounds were obtained. The structures of the 10 known compounds were clarified by spectroscopic analysis and comparisons with reported physical data, permitting the identification of dalbergioidin (1),19,20 salicylic acid (2),21 vitexin (4),22 tryptophan (5),23 maltol-3-O-β-D-glucopyranoside (6),24 adenosine (7),25 spatholosineside A (8),26 byzantionoside B (9),27 (7R,8R)-threo-guaiacylglycerol-8-O4′-sinapyl ether 7-O-β-D-glucopyranoside (10),28 and thymine (11)29 (Figure 2). The new compound 3 was obtained as a yellow solid. Its molecular formula was determined, from its positive HRESIMS m/z 535.1459 [M + H]+ (calculated for C25H27O13+, 535.1452), to be C25H26O13, a result consistent with the NMR data (Table 1). The NMR spectrum showed δH 6.75 (1H, s, H-3) together with signals of δC 102.8 (C-3), 163.5 (C-2), and 181.8 (C-4), a spectrum that suggested the presence of flavone moieties. The presence of signals at δH 6.91 (2H, d, J = 8.8 Hz, H-3′, H-5′) and 7.92 (2H, d, J = 8.8 Hz, H-2′, H-6′) in an A2X2 coupling system, together with signals of δC 116.0 (C-3′, C-5′) and 128.5 (C-2′, C-6′) observed in the NMR spectra suggested a monosubstituted aromatic moiety (ring B) in 3. In the heteronuclear multiple bond correlation (HMBC) spectrum (Figure 2), one aromatic signal, δH 6.51 (1H, s, H-8), was assigned at H-8 due to long-range coupling with C-6, C-7, and C-9. These data suggested that 3 had a 4′,5,7,-trihydroxyflavone (apigenin) skeleton. The NMR spectrum at δH 2.52 to 5.15 and δC 64.5 to 109.1 also showed two sugar signals in the structure. After acid hydrolysis of 3, the aqueous layer was separated by HPLC and

■

RESULTS AND DISCUSSION Effect of U. crinita Extracts on Osteogenic Differentiation and Matrix Mineralization in HOb Cells. The fresh roots of U. crinita were extracted with 95% ethanol (EtOH) three times and the extract evaluated for osteogenic activity in HOb cells. This extract increased early bone differentiation marker alkaline phosphatase (ALP) activity and late mineralization activity by 106.51 ± 0.44 and 130.45 ± 1.51%, respectively (Figure 1A, B, and C). A bioguided method was then used to isolate and purify the active ingredients from the extract. Three fractions, EtOAc, n-BuOH, and aqueous fractions, were evaluated by the 3-(4,5-dimethylthiazol-2-yl)2,5-diphenyltetrazolium bromide (MTT) assay. No significant toxic effects were observed in HOb cells when 100 μg/mL concentrations of these extracts were used. The effects of these fractions on ALP activity and the calcium contents of the mineralized matrix of the HOb cells were then evaluated. Treatment with the aqueous fraction caused a 119.36 ± 5.64% increase in ALP activity (Figure 1A). Treatment with either the EtOAc or n-BuOH fraction significantly increased the calcium content of the mineralized matrix by 123.11 ± 3.28 and 146.73 ± 2.85%, respectively (Figure 1B and C). During bone formation, osteoblast maturation causes bone matrix synthesis, and the bone matrix becomes progressively mineralized in the terminal stages of synthesis. The EtOAc and n-BuOH fractions significantly increased the calcium content of 5584

dx.doi.org/10.1021/jf5012177 | J. Agric. Food Chem. 2014, 62, 5581−5588

Journal of Agricultural and Food Chemistry

Article

Figure 3. Effects of isolated compounds from U. crinita on cell viability, ALP activity, and mineralization in HOb cells. HOb cells were seeded in 96-well plates and treated with 100 μM of the indicated compounds for 72 h. (A) Cell viability was assessed using the MTT assay. (B) ALP activity was measured using a colorimetric assay with p-nitrophenyl phosphate disodium as the substrate. (C) HOb cells were plated in 24-well plates and treated with 100 μM of the indicated compounds for 12 days. Mineralized nodule formation was assessed by alizarin red-S staining. (D) Quantitative analysis of the extent of mineralization. Data are presented as the mean ± SD (n = 3). * p < 0.05 and ** p < 0.01 compared to control cells (C, control; D, daidzein).

formation were assessed in HOb cells. Cell viability was measured using the MTT assay. Excluding compound 5, none of the compounds at 100 μM reduced cell viability by more than 10% (Figure 3A). The effects of the nontoxic compounds on early osteoblast differentiation were investigated using an ALP activity assay, and their effects on late mineralization were assessed using alizarin red staining. The novel apigenin 6-C-β-Dapiofuranosyl(1→2)-α-D-xylopyranoside (3) and the known compounds dalbergioidin (1), adenosine (7), and byzantionoside B (9), significantly increased ALP activity in HOb cells by 109.68 ± 2.20, 114.10 ± 4.41, 108.70 ± 4.14, and 114.81 ± 0.18%, respectively (Figure 3B), when used at a concentration of 100 μM and also increased the calcium contents of the mineralized matrix by 150.10 ± 0.80, 107.09 ± 2.80, 125.21 ± 3.75, and 129.21 ± 6.13%, respectively (Figure 3C and D). Effects of the Isolated Compounds on OsteogenesisRelated mRNA Expression in HOb Cells. We further investigated whether these four isolated compounds were able to promote osteogenesis-related mRNA expression by quantitative real-time PCR (Q-RT-PCR). At a concentration of 100 μM, dalbergioidin (1) upregulated the mRNA expression

compared to sugar standards to reveal one major sugar, apiose. The presence of C-D-xylopyranoside30 and D-apiofuranoside31 were determined from NMR, heteronuclear single quantum coherence (HSQC), 1H−1H correlation spectroscopy (COSY), HMBC spectra, and reported physical data.32 Collectively, these data indicated that compound 3 was an apigenin linked with C-D-xylopyranoside and D-apiofuranoside moieties. The linkage of the sugar residues to the apigenin nucleus (C-1″ → C-6) was supported by the downfield NMR shifts of H-1″ (δH 4.55) of the C-D-xylopyranoside and the C-6 (δC 108.8) of the apigenin.30,33,34 The position of the D-apiofuranoside and C-D-xylopyranoside linkage (C-1‴ → C-2″) was confirmed as C-1‴ at δC 109.1 and H-2″ at δH 4.27 (1H, brs) by HMBC correlations. The α-configuration of D-xylopyranoside and the β-configuration of D-apiofuranoside were deduced by the coupling constants of the anomeric protons H-1″ (δH 4.55, brs) and H-1‴ (δH 5.15, brs).35 On the basis of these data, the structure of 3 was identified as apigenin 6-C-β-D-apiofuranosyl(1→2)-α-D-xylopyranoside. Effects of the Isolated Compounds on Cell Viability, Osteogenic Differentiation, and Matrix Mineralization in HOb Cells. The effects of the isolated compounds on bone 5585

dx.doi.org/10.1021/jf5012177 | J. Agric. Food Chem. 2014, 62, 5581−5588

Journal of Agricultural and Food Chemistry

Article

of OPN, BMP-2, and Runx2 by 1.25 ± 0.05-, 1.21 ± 0.07-, and 1.71 ± 0.05-fold, respectively. Apigenin 6-C-β-D-apiofuranosyl(1→2)-α-D-xylopyranoside (3) increased the expression of these substances by 1.39 ± 0.01-, 1.30 ± 0.04-, 1.43 ± 0.10-fold, respectively, adenosine (7) upregulated their expression by 1.14 ± 0.04-, 1.16 ± 0.09-, and 1.55 ± 0.05-fold, respectively, and byzantionoside B (9) increased their expression by 1.32 ± 0.07-, 1.21 ± 0.04-, and 1.28 ± 0.09-fold, respectively. The novel apigenin 6-C-β-D-apiofuranosyl(1→2)-α-D-xylopyranoside (3), dalbergioidin (1), adenosine (7), and byzantionoside B (9) increased OPN, BMP-2, and Runx2 mRNA expression in a concentration-dependent manner (Figure 4A, B, and C). The BMP family plays an important role in the process of bone formation and remodeling.36 In osteoblast cells, the action of BMP-2 is mediated by its binding to BMP-2 receptors and subsequent downstream regulation of the SMAD transcription factor SMAD1/5/8, which then forms a complex with SMAD4. Phosphorylated SMAD complexes translocate to the cell nucleus and bind to transcription factors including Runx2, Dlx5, and Osterix.9,37 Extensive studies have demonstrated that BMPs stimulate osteoblast differentiation by upregulating Runx-2 expression and increasing the expression of ALP, type I collagen, OPN, and osteocalcin.37 This is the first report demonstrating that apigenin 6-C-β-D-apiofuranosyl(1→2)-α-D-xylopyranoside (3), dalbergioidin (1), and byzantionoside B (9) significantly increase ALP activity in the early differentiation phase and OPN mRNA expression and bone nodule formation in the late mineralization phase in HOb cells. The osteogenic activity of the three compounds probably occurs through activation of the BMP-2/ Smad/Runx2 signaling pathway, and these compounds had greater effects than daidzein (4′,7-dihydroxyisoflavone), the positive control, in HOb cells. Daidzein has been reported to induce the differentiation of rat or porcine osteoblast cells by upregulating BMP-2/Runx2 expression.38,39 Adenosine (7) has been shown to increase osteoblast differentiation and bone formation in previous studies.40,41 Natural isoflavonoids, such as daidzein, genistein (4′,5,7-trihydroxyisoflavone), and genistin (4′,5-dihydroxyisoflavone-7-O-glucoside), that enhance the expression of ALP, OCN, BMP-2, and osteoprotegerin have been reported to promote bone differentiation and mineralization both in vitro and in vivo.39,42−44 Comparing dalbergioidin (1) (2′,4′,5,7-tetrahydroxyisoflavone) and the three isoflavones (genistein, genistin, and daidzein), we found that the OH groups at C-4′ and C-7 may be the important features of isoflavones needed for promoting bone formation. Additionally, compared with the flavonoid-6-C-glucosides of compound 3 and flavonoid 8-C-glucosides of compound 4, we also observed that flavonoid-6-C-glycoside was an important unit for eliciting better osteogenic activity. The same pattern of flavonoid-6-C-glycoside was also found in the previous literature.45 Our studies demonstrated that these four active compounds contained in U. crinita could stimulate osteogenic activity and enhance bone formation, possibly through the BMP-2/Smad/ Runx2 pathway. Further studies are needed to understand the influence of different solvents and extraction methods on the osteogenic activity of U. crinita. In conclusion, U. crinita extract contained the novel apigenin 6-C-β-D-apiofuranosyl(1→2)-α-D-xylopyranoside (3), which together with dalbergioidin (1), adenosine (7), and byzantionoside B (9) showed osteogenic activity by increasing ALP activity and calcium contents to regulate differentiation and mineralization in human osteoblast cells. Their mechanism of action may be through activation of the BMP-2 and Runx2 signal pathways. This is the first report that U. crinita and its

Figure 4. Effects of active compounds from U. crinita on osteogenesisrelated mRNA expression in HOb cells. HOb cells were seeded in 6 cm dishes and treated with the indicated compounds for 24 h. Concentration-dependent effects of active compounds 1, 3, 7, and 9 on (A) OPN, (B) BMP-2, and (C) Runx2 mRNA expression were determined by Q-RT-PCR analysis. Using the 2−ΔΔCt method, Runx2, BMP-2, and OPN mRNA expression results were normalized against GAPDH expression. Data are presented as the mean ± SD (n = 3). * p < 0.05 and ** p < 0.01 compared to control cells (C, control; D, daidzein).

active compounds exhibit osteogenic activity and suggests that in the future active constituents from this species may be applied for the prevention of bone loss and promotion of bone regeneration. 5586

dx.doi.org/10.1021/jf5012177 | J. Agric. Food Chem. 2014, 62, 5581−5588

Journal of Agricultural and Food Chemistry

■

Article

quadrangularis on the proliferation, differentiation and matrix mineralization of human osteoblast like SaOS-2 cells. J. Cell. Biochem. 2011, 112, 1035−1045. (7) Aubin, J. E.; Liu, F.; Malaval, L.; Gupta, A. K. Osteoblast and chondroblast differentiation. Bone 1995, 17, 77S−83S. (8) Yang, H. M.; Shin, H. K.; Kang, Y. H.; Kim, J. K. Cuscuta chinensis extract promotes osteoblast differentiation and mineralization in human osteoblast-like MG-63 cells. J. Med. Food 2009, 12, 85−92. (9) Chen, G.; Deng, C.; Li, Y. P. TGF-beta and BMP signaling in osteoblast differentiation and bone formation. Int. J. Biol. Sci. 2012, 8, 272−288. (10) Phimphilai, M.; Zhao, Z.; Boules, H.; Roca, H.; Franceschi, R. T. BMP signaling is required for RUNX2-dependent induction of the osteoblast phenotype. J. Bone Miner. Res. 2006, 21, 637−646. (11) Taira, M.; Nakao, H.; Takahashi, J.; Araki, Y. Effects of two vitamins, two growth factors and dexamethasone on the proliferation of rat bone marrow stromal cells and osteoblastic MC3T3-E1 cells. J. Oral Rehabil. 2003, 30, 697−701. (12) Wang, X.; Wu, J.; Chiba, H.; Yamada, K.; Ishimi, Y. Puerariae radix prevents bone loss in castrated male mice. Metabolism 2005, 54, 1536−1541. (13) Jeong, J. C.; Lee, J. W.; Yoon, C. H.; Lee, Y. C.; Chung, K. H.; Kim, M. G.; Kim, C. H. Stimulative effects of Drynariae Rhizoma extracts on the proliferation and differentiation of osteoblastic MC3T3-E1 cells. J. Ethnopharmacol. 2005, 96, 489−495. (14) Hsieh, T. P.; Sheu, S. Y.; Sun, J. S.; Chen, M. H.; Liu, M. H. Icariin isolated from Epimedium pubescens regulates osteoblasts anabolism through BMP-2, SMAD4, and Cbfa1 expression. Phytomedicine 2010, 17, 414−423. (15) Hsu, F. L.; Chou, C. J.; Chang, Y. C.; Chang, T. T.; Lu, M. K. Promotion of hyphal growth and underlying chemical changes in Antrodia camphorata by host factors from Cinnamomum camphora. Int. J. Food Microbiol. 2006, 106, 32−38. (16) Scudiero, D. A.; Shoemaker, R. H.; Paull, K. D.; Monks, A.; Tierney, S.; Nofziger, T. H.; Currens, M. J.; Seniff, D.; Boyd, M. R. Evaluation of a soluble tetrazolium/formazan assay for cell growth and drug sensitivity in culture using human and other tumor cell lines. Cancer Res. 1988, 48, 4827−4833. (17) Hsu, Y. L.; Chang, J. K.; Tsai, C. H.; Chien, T. T.; Kuo, P. L. Myricetin induces human osteoblast differentiation through bone morphogenetic protein-2/p38 mitogen-activated protein kinase pathway. Biochem. Pharmacol. 2007, 73, 504−514. (18) Wang, Y. H.; Liu, Y.; Maye, P.; Rowe, D. W. Examination of mineralized nodule formation in living osteoblastic cultures using fluorescent dyes. Biotechnol. Prog. 2006, 22, 1697−1701. (19) Benavides, A.; Bassarello, C.; Montoro, P.; Vilegas, W.; Piacente, S.; Pizza, C. Flavonoids and isoflavonoids from Gynerium sagittatum. Phytochemistry 2007, 68, 1277−1284. (20) Durango, D.; Quinones, W.; Torres, F.; Rosero, Y.; Gil, J.; Echeverri, F. Phytoalexin accumulation in Colombian bean varieties and aminosugars as elicitors. Molecules 2002, 7, 817−832. (21) Scott, K. N. Carbon-13 nuclear magnetic resonance of biologically important aromatic acids. I. Chemical shifts of benzoic acid and derivatives. J. Am. Chem. Soc. 1972, 94, 8564−8568. (22) Krafczyk, N.; Glomb, M. A. Characterization of phenolic compounds in rooibos tea. J. Agric. Food Chem. 2008, 56, 3368−3376. (23) Lee, M.; Phillips, R. S. Fluorine substituent effects for tryptophan in carbon-13 nuclear magnetic resonance. Magn. Reson. Chem. 1992, 30, 1035−1040. (24) Ono, M.; Masuoka, C.; Tanaka, T.; Ito, Y.; Nohara, T. Antioxidative and antihyaluronidase activities of some constituents from the aerial part of Daucus carota. Food Sci. Technol. Res. 2001, 7, 307−310. (25) Moyroud, E.; Strazewski, P. L-Ribonucleosides from L-xylose. Tetrahedron 1999, 55, 1277−1284. (26) Yin, T.; Liu, H.; Wang, B.; Tu, G.; Liang, H.; Zhao, Y. Chemical constituents from Spatholobus sinensis. Yaoxue Xuebao 2008, 43, 67− 70.

ASSOCIATED CONTENT

S Supporting Information *

NMR and HR-ESI-MASS spectra of compound 3. This material is available free of charge via the Internet at http://pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Author

*Tel: +886-2-2736-1661 ext. 6151. Fax: +886-2-2735-7983. E-mail: [email protected]. Funding

This study was supported by a grant from the National Science Council, Taiwan (NSC101-2320-B-038-014-MY3). Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS We thank Shwu-Huey Wang (Instrumentation Center of Taipei Medical University) and Shou-Ling Huang (Nuclear Magnetic Resonance Lab, Instrumentation Center College of Science, National Taiwan University) for the NMR data acquisition and Dr. Mei-Kuang Lu (National Research Institute of Chinese Medicine, Taiwan) for acid hydrolysis and monosaccharide analysis.

■

ABBREVIATIONS USED ALP, alkaline phosphatase; BCA, bicinchoninic acid; BMP, bone morphogenetic protein; BuOH, butanol; COSY, correlation spectroscopy; DMSO, dimethyl sulfoxide; ECM, extracellular matrix; EtOAc, ethyl acetate; EtOH, ethanol; HMBC, heteronuclear multiple bond correlation; HOb, human osteoblast; HPAEC, high-performance anion-exchange chromatography; HPLC, high-performance lipid chromatography; HRESI-MS, high-resolution eletrospray ionization mass spectroscopy; HSQC, heteronuclear single quantum coherence; MeOH, methanol; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; ODM, osteoblast differentiation medium; OGM, osteoblast growth medium; OPN, osteopontin; NMR, nuclear magnetic resonance; PBS, phosphate-buffered saline; Runx2, runt-related transcription factor 2; TGF, transforming growth factor; UPL, Universal Probe Library

■

REFERENCES

(1) Hsu, S. Y.; Liu, K. C. Studies on the Anti-ulcer Actions of Chinese Herbs and Folk Medicines (III); The Annual Reports of the National Research Institutes of Chinese Medicine; National Research Institutes of Chinese Medicine: Taipei, Taiwan, 1983; pp 31−41. (2) Yen, G. C.; Lai, H. H.; Chou, H. Y. Nitric oxide-scavenging and antioxidant effects of Uraria crinita root. Food Chem. 2001, 74, 471− 478. (3) Liu, S. Y.; Liou, P. C.; Wang, J. Y.; Shyu, Y. T.; Hu, M. F.; Chang, Y. M.; Shieh, J. I. Production and Electrophoretic Analysis of Medical Plants in Taiwan. In Proceeding of a Symposium on Development and Utilization of Resources of Medicinal Plants in Taiwan; Tu, C. C., Lu, H. S., Liu, S. Y., Eds.; Taiwan Agricultural Research Institute: Taichung, Taiwan, 1995; pp 149−188. (4) Wang, Y.; Zhang, X.; Gong, L.; Ruan, H.; Pi, H.; Zhang, Y. Studies on chemical constituents in roots of Uraria crinita. Zhongguo Yaoxue Zazhi 2009, 44, 1217−1220. (5) Morita, N.; Arisawa, M.; Nagase, M.; Hsu, H. Y.; Chen, Y. P. Studies on the constituents of Formosan Leguminosae. II. The constituents in the leaves of Uraria crinita Desv. Yakugaku zasshi 1977, 97, 701−703. (6) Muthusami, S.; Senthilkumar, K.; Vignesh, C.; Ilangovan, R.; Stanley, J.; Selvamurugan, N.; Srinivasan, N. Effects of Cissus 5587

dx.doi.org/10.1021/jf5012177 | J. Agric. Food Chem. 2014, 62, 5581−5588

Journal of Agricultural and Food Chemistry

Article

(27) Matsunami, K.; Otsuka, H.; Takeda, Y. Structural revisions of blumenol C glucoside and byzantionoside B. Chem. Pharm. Bull. 2010, 58, 438−441. (28) Machida, K.; Sakamoto, S.; Kikuchi, M. Two new neolignan glycosides from leaves of Osmanthus heterophyllus. J. Nat. Med. 2009, 63, 227−231. (29) Pouchert, C. J.; Behnke, J. The Aldrich Library of 13C and 1H FT NMR Spectra; Aldrich Chemical Company: Milwaukee, WI, 1993; pp 367. (30) Fiorentino, A.; D’Abrosca, B.; Pacifico, S.; Izzo, A.; Letizia, M.; Esposito, A.; Monaco, P. Potential allelopathic effects of stilbenoids and flavonoids from leaves of Carex distachya Desf. Biochem. Syst. Ecol. 2008, 36, 691−698. (31) Phan, V. K.; Nguyen, X. C.; Nguyen, X. N.; Vu, K. T.; Ninh, K. B.; Chau, V. M.; Bui, H. T.; Truong, N. H.; Lee, S. H.; Jang, H. D.; Kim, Y. H. Antioxidant activity of a new C-glycosylflavone from the leaves of Ficus microcarpa. Bioorg. Med. Chem. Lett. 2011, 21, 633−637. (32) Dubois, M. A.; Zoll, A.; Bouillant, M. L.; Chopin, J. New Cglycosylflavones from Cerastium arvense. Phytochemistry 1982, 21, 1141−1143. (33) Loizzo, M. R.; Said, A.; Tundis, R.; Rashed, K.; Statti, G. A.; Hufner, A.; Menichini, F. Inhibition of angiotensin converting enzyme (ACE) by flavonoids isolated from Ailanthus excelsa (Roxb) (Simaroubaceae). Phytother. Res. 2007, 21, 32−36. (34) Aquino, R.; Morelli, S.; Lauro, M. R.; Abdo, S.; Saija, A.; Tomaino, A. Phenolic constituents and antioxidant activity of an extract of Anthurium versicolor leaves. J. Nat. Prod. 2001, 64, 1019− 1023. (35) Shie, J. J.; Chen, C. A.; Lin, C. C.; Ku, A. F.; Cheng, T. R.; Fang, J. M.; Wong, C. H. Regioselective synthesis of di-C-glycosyl-flavones possessing antiinflammation activities. Org. Biomol. Chem. 2010, 8, 4451−4462. (36) Nishimura, R.; Hata, K.; Matsubara, T.; Wakabayashi, M.; Yoneda, T. Regulation of bone and cartilage development by network between BMP signalling and transcription factors. J. Biochem. 2012, 151, 247−254. (37) Ryoo, H. M.; Lee, M. H.; Kim, Y. J. Critical molecular switches involved in BMP-2-induced osteogenic differentiation of mesenchymal cells. Gene 2006, 366, 51−57. (38) De Wilde, A.; Lieberherr, M.; Colin, C.; Pointillart, A. A low dose of daidzein acts as an ERbeta-selective agonist in trabecular osteoblasts of young female piglets. J. Cell. Physiol. 2004, 200, 253− 262. (39) Jia, T. L.; Wang, H. Z.; Xie, L. P.; Wang, X. Y.; Zhang, R. Q. Daidzein enhances osteoblast growth that may be mediated by increased bone morphogenetic protein (BMP) production. Biochem. Pharmacol. 2003, 65, 709−715. (40) Inoue, A.; Hiruma, Y.; Hirose, S.; Yamaguchi, A.; Hagiwara, H. Reciprocal regulation by cyclic nucleotides of the differentiation of rat osteoblast-like cells and mineralization of nodules. Biochem. Biophys. Res. Commun. 1995, 215, 1104−1110. (41) Mediero, A.; Cronstein, B. N. Adenosine and bone metabolism. Trends. Endocrinol. Metab. 2013, 24, 290−300. (42) Chang, H.; Jin, T. Y.; Jin, W. F.; Gu, S. Z.; Zhou, Y. F. Modulation of isoflavones on bone-nodule formation in rat calvaria osteoblasts in vitro. Biomed. Environ. Sci. 2003, 16, 83−89. (43) Li, X. H.; Zhang, J. C.; Sui, S. F.; Yang, M. S. Effect of daidzin, genistin, and glycitin on osteogenic and adipogenic differentiation of bone marrow stromal cells and adipocytic transdifferentiation of osteoblasts. Acta Pharmacol. Sin. 2005, 26, 1081−1086. (44) Morris, C.; Thorpe, J.; Ambrosio, L.; Santin, M. The soybean isoflavone genistein induces differentiation of MG63 human osteosarcoma osteoblasts. J. Nutr. 2006, 136, 1166−1170. (45) Rawat, P.; Kumar, M.; Sharan, K.; Chattopadhyay, N.; Maurya, R. Ulmosides A and B: flavonoid 6-C-glycosides from Ulmus wallichiana, stimulating osteoblast differentiation assessed by alkaline phosphatase. Bioorg. Med. Chem. Lett. 2009, 19, 4684−4687.

5588

dx.doi.org/10.1021/jf5012177 | J. Agric. Food Chem. 2014, 62, 5581−5588